Question

E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon of a gene involved in Brugada syndrome (a cardac disorder characterized by an abnormal electrocardiogram and an increased risk of sudden heart failure) is shown. The first exon includes the start codon. The genomic DNA of four people (1-4) was subjectesd to sequencing. The following sequences represent all those obtained from each person Nucledtides different from the RefSeq are underlined. RefSeq 5 CA ACG CTT AGG ATG TGC GGA GCC T3 Individual 1: 5 CA ACG CTT AGG ATG TGC GGA GCCT3 5 CA ACG CTT AGG ATG TGC GGA GAC 73 Individual 2 5 CA ACG CTT AGG ATG TGA GGA GCC T 3 Individual 3: 5 CA ACG CTT AGG ATG TGC GGA GCC T3 5 CA ACG CTT AGG ATG GCG GAG CCT3 Individual 4 5 CA ACG CTT AGG ATG TGC GGA GCC T3 5 CA ACG CTT AGG ATG TCT GGA GCC T3 34. Which individuals show SNP compared to RefSeq? B. 1, 3 D. 1, 2, 4 35. What is the nature of mutation in individual 1? sense sense E silent shift 36. What is the nature of mutation in individual 2? A. nonsense B. missense C. silent D. frameshift 37. What is the nature of mutation in individual 3? A. nonsense B. missense C. silent D. frameshift
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Please find the answers below:

Answer 34: Choice D (SNP refers to single nucleotide polymorphism which includes change in single nucleotide in the sequence, hence individuals 1, 2 and 4)

Answer 35: Choice B (The original triplet of nucleotide encodes for amino acid alanine while mutated sequence encodes for asparagine, hence a mis-sense mutation)

Answer 36: Choice A (Since the original sequence encodes for amino acid cystein while the mutated sequence is non-coding in nature, it will become a stop codon, hence a non-sense mutation)

Answer 37: Choice D (The concurrent change in the codons leads to alteration of the whole reading frame of the sequence, hence a frame-shift mutation)

Add a comment
Know the answer?
Add Answer to:
E. TAGGTGAAAGAAATCAGTTA UT EID: 4-38. The human RefSeg of the entire first exon of a gene...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • D) Consider that during replication of the cell. the following mutations were generated within the gene...

    D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT