
Select 2 primers from bold/underlining DNA :
Forward primer : 5' ( ACTACGAGTGTGACAACG ) 3'
Reverse Primer : 5' ( CCACTTCGCGCGAGCATT ) 3'
- Forwerd primer is binds to the first bold section.
- A forward primer is a 18 bp single strand of DNA.
- The most important thing about a primer is making sure it will bind complimentarily to your target DNA sequence.
- If done correctly and the length is good, the primer should bind in one spot only: where you want it to.
- It can be used for sequencing (to find out the sequence of things that come after it in ) direction, or 5' to 3'. Most likely, a forward primer is used for PCR.
- However, in order to do PCR, you need a reverse primer.
- Reverse primer selecte from last row of bold DNA fragment.
- Notice that this doesn't match the sequence I have provided.
- This is because DNA is double stranded, so if you want to prime in the opposite direction, you need to compliment the bases, and read in the opposite direction.
5' ATGC 3' becomes:
| | | |
3' TACG 5'
Notice how they are complimentary? Now, read it from 5' to 3', and you will have your reverse primer.
Can you answer and explain it please Q. You want to PCR amplify the underlined/bold DNA...
You want to use PCR to amplify the entire DNA shown in the figure below. Of the listed primers, choose the pair that will allow you to amplify this stretch of DNA by PCR. (9 points total) DNA to be amplified 5’-CGATTCGAGCCATTCGAACTCGATCAGCCGATTCGATCAACCTTGGACAGTCAG-3’ 3’-GCTAAGCTCGGTAAGCTTGAGCTAGTCGGCTAAGCTAGTTGGAACCTGTCAGTC-5’ Primers: (1) 5’-GCTAAGCTCGGTA-3’ (5) 5’-CTTGGACAGTCAG-3’ (2) 5’-GAACCTGTCAGTC-3’ (6) 5’-CGATTCGAGCCAT-3’ (3) 5’-CTGACTGTCCAAG-3’ (7) 5’-ATGGCTCGAATCG-3’ (4) 5’-GACTGACAGGTTC-3’ (8) 5’-TACCGAGCTTAGC-3’ Answer: I will need primer number _____ and primer number _____
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...
help with the whole question 9 please.
9. a) You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR List the components that need to be included in any standard PCR, give the function of each. A PCR is typically performed in an automated thermo cycling machine. Give the three steps required in each cycle, and explain the function of each. The figure below represents a step during the first PCR cycle....
design a forward and reverse PCR primer based on underlined sequence in the following DNA sequence. 3' AAGCCAGGCCCTGGAGT......................TGGACTCGTGGGTGTG.....5' What does "PCR stand for and briefly describe PCR program
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...
EXPLAIN each answer thoroughly. There are two common goals when using PCR to amplify DNA. A. Make lots of copies of a specific DNA sequence to use in cloning (preparative PCR) B. Detect the presence or relative amount of a specific gene under varying conditions (analytical PCR) *Remember: PCR is very similiar to DNA replication, but uses a DNA polymerase to amplify only specific parts of DNA sequence based on the sequence of the primers. 3. For which goal (A...
need help with this
Tm: Tm: 16. You wish to amplify the DNA fragments below and add cut sites for subsequent cloning. Design both primers with the restriction enzymes cut sites listed, and add two overhang bases to each primer. Label the extra bases and cut sites. Each primer should be 14 nucleotides in length. a. 5'-CTATGAGGTCCTGCGTTAGTGTTACC-3' Forward: 5'- 5' EcoRI, 3' BamHI, overhang bases Reverse: 5'- Annealing Temperature: b. 5'- CCTGGGTGTTACATGCCATTAGCGTT-3' Forward: 5'- Tm: 5' HindiII, 3' Sphl, overhang...
1. Explain why, when PCR is used to amplify the same region of DNA from two different people, the size of the DNA fragment(s) generated may be different? 2. What characteristic of the DNA molecule makes it possible to use electrophoresis to separate DNA molecules by size? Explain why this characteristic is important for electrophoresis and what part of the DNA molecule creates this characteristic. 3. You are performing PCR. After four cycles of PCR, how many double-stranded copies of...