The unit of length in this question is Kmer.
In search size of 16mer, with two spaced 4mer seeds in each genomic location. For example. each 16 nucleotide window in the genome is represented.
As described above, how many entries in a spaced seed index?
Explanation would be greatly appreciated.
Assignment website said 2 is not the answer.
K-mers are a fairly simple concept that turn out to be tremendously powerful.
A “k-mer” is a word of DNA that is k long:
ATTG - a 4-mer ATGGAC - a 6-mer
Typically we extract k-mers from genomic assemblies or read data sets by running a k-length window across all of the reads and sequences – e.g. given a sequence of length 16, you could extract 11 k-mers of length six from it like so:
AGGATGAGACAGATAG
becomes the following set of 6-mers:
AGGATG
GGATGA
GATGAG
ATGAGA
TGAGAC
GAGACA
AGACAG
GACAGA
ACAGAT
CAGATA
AGATAG
k-mers are most useful when they’re long, because then they’re specific. That is, if you have a 31-mer taken from a human genome, it’s pretty unlikely that another genome has that exact 31-mer in it. (You can calculate the probability if you assume genomes are random: there are 431possible 31-mers, and 431 = 4,611,686,018,427,387,904. So, you know, a lot.)
The important concept here is that long k-mers are species specific. We’ll go into a bit more detail later.
K-mers and assembly graphs
We’ve already run into k-mers before, as it turns out - when we were doing genome assembly. One of the three major ways that genome assembly works is by taking reads, breaking them into k-mers, and then “walking” from one k-mer to the next to bridge between reads. To see how this works, let’s take the 16-base sequence above, and add another overlapping sequence:
AGGATGAGACAGATAG
TGAGACAGATAGGATTGC
One way to assemble these together is to break them down into k-mers –
becomes the following set of 6-mers:
AGGATG
GGATGA
GATGAG
ATGAGA
TGAGAC
GAGACA
AGACAG
GACAGA
ACAGAT
CAGATA
AGATAG -> off the end of the first sequence
GATAGG <- beginning of the second sequence
ATAGGA
TAGGAT
AGGATT
GGATTG
GATTGC
and if you walk from one 6-mer to the next based on 5-mer overlap, you get the assembled sequence:
AGGATGAGACAGATAGGATTGC
Graphs of many k-mers together are called De Bruijn graphs, and assemblers like MEGAHIT and SOAPdenovo are De Bruijn graph assemblers - they use k-mers underneath.
The unit of length in this question is Kmer. In search size of 16mer, with two...
Make a program using Java that asks the user to input an integer
"size". That integer makes and prints out an evenly spaced, size by
size 2D array (ex: 7 should make an index of 0-6 for col and rows).
The array must be filled with random positive integers less than
100. Then, using recursion, find a "peak" and print out its number
and location. (A peak is basically a number that is bigger than all
of its "neighbors" (above,...
UNIT 33 | Embryonic Development and Heredity 671 s. What is the specific function of the two umbilical arteries? 2. Observe a fresh or preserved animal fetus and placenta, if available. Identify the following structures and then write a brief description of each a. Placenta b. Amnion (amniotic sac) c. Umbilical cord 蚰鷊 3. Observe a model of a pregnant human torso, if available Figre33-7 Human male karyotype with 23 pairs The placenta is located in which region of the...
For this assignment, your job is to create a simple game called
Opoly.
The objectives of this assignment are to:
Break down a problem into smaller, easier problems.
Write Java methods that call upon other methods to accomplish
tasks.
Use a seed value to generate random a sequence of random
numbers.
Learn the coding practice of writing methods that perform a
specific task.
Opoly works this way: The board is a circular track of variable
length (the user determines the...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
***JAVA: Please make "Thing" movies.
Objective In this assignment, you are asked to implement a bag collection using a linked list and, in order to focus on the linked list implementation details, we will implement the collection to store only one type of object of your choice (i.e., not generic). You can use the object you created for program #2 IMPORTANT: You may not use the LinkedList class from the java library. Instead, you must implement your own linked list...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
Assignment Details The Unit 6 Assignment requires you to consider how effective teams are built. Some considerations in this assignment include the traits of an effective team leader as well as the strategies one would use to recruit team members that would work effectively together. Using material from Chapter 12 of your text as well as the article in the supplemental reading (Rao, 2016), you will write an informative essay sharing best practices for effective team-building. Outcomes evaluated through this...
Overview: You will be writing classes that implement a playlist simulation for a music streaming app.The Playlist class will contain a dynamic array of Song objects, and the Song class contains several pieces of information about a song. You will need to: 1) Finish the writing of two classes: Song and Playlist. The full header file for the Song class has been provided in a file called Song.h. 2) Write a main program (filename menu.cpp) that creates a single Playlist...
can
u tell me if these answers are correct please!??!!!
Choose the best answer for the following questions. Place your answer on the line. If your answer is not on the line.it does not count 1 Mender's discovery that characteristics are inherited due to the transmission of hereditary factors resulted from his (1) dissections to determine how fertilization occurs in pea plants (2analysis of the offspring produced from many pea plant crosses (3) careful microscopic examinations of genes and chromosomes...
code in java please:)
Part I Various public transporation can be described as follows: A PublicTransportation class with the following: ticket price (double type) and mumber of stops (int type). A CityBus is a PublicTransportation that in addition has the following: an route number (long type), an begin operation year (int type), a line name (String type), and driver(smame (String type) -A Tram is a CityBus that in addition has the following: maximum speed (int type), which indicates the maximum...