The 5’ UTR is transcribed but not translated, therefore it must be _________ from the transcription start site (TSS) and _________ from the translational start codon. Likewise, the 3’ UTR must be _________ from the translational stop codon and __________ from the transcription stop site (terminator).
a. upstream, downstream, upstream, downstream
b. upstream, downstream, downstream, upstream
c. downstream, upstream, downstream, upstream
d. downstream, upstream, upstream, downstream
The 5’ UTR is transcribed but not translated, therefore it must be _________ from the transcription...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: А H DNA TTGACA TATAAT -35 B -10 C D Start codon Stop codon mRNA 5 E F G Is this a prokaryotic or eukaryotic transcription unit? What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoters Pribnow box Non-template strand Transcriptional start site- Open Reading...
1. EORA BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA onthe left the translational start colon . but they are s RBS ribosome binding site...
Question 2. FOR A BACTERIAL GENE, writing left-to-right, show the relative positions of each of these genetic elements as they would appear in the DNA from upstream on the left to downstream on the right. Of course, some of these genetic elements will only be active once they are in mRNA (e.g., the translational start codon), but they are still found encoded in the sequence of DNA. RBS ribosome binding site UAA translational stop site (UAA) TSS transcriptional start site...
For A I need help identifying which row of sequence each of the
features are located on.
For B I need help understanding what would happen if the base
highlighted in the second row of sequence changed from "g" to
"a"
And for C I need help understanding what would occur if the base
highlighted in the first row of sequence changes from "a" to
"c"
The sequence of a simplified Eukaryotic protein-coding Rene region is shown below. The sequence...
Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...
1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
where does transcription begin
3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
The FMR1 gene contains a trinucleotide CGG repeat. A schematic of the first exon at the 5’ end of the gene is shown below, with the transcription start site (TSS) and translational start site (AUG codon) marked. The location of the CGG repeat is indicated as well. The length of the CGG repeat affects the ____________ sequence. (Select all that apply.) 1. mature mRNA 2.primary RNA 3.protein 4. DNA
1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...