Question

Some amino acids such as Ile, Met, and Leu have nonpolar, aliphatic radical groups, while others...

Some amino acids such as Ile, Met, and Leu have nonpolar, aliphatic radical groups, while others such as Ser, Cys, Glu, Pro, Asn, and Thr have polar uncharged radical groups. Where in proteins would you expect to find amino acids such as Ile, Met, and Leu but not amino acids such as Ser, Cys, Glu, Pro, Asn and Thr?

A.on an outside surface interacting with water

B.folded inside a central, core region that does not interact with water

C.not within transmembrane regions that interact with the lipid bilayer

D.in regions where hydrogen bonding is important

0 0
Add a comment Improve this question Transcribed image text
Answer #1

B. folded inside a central, core region that does not interact with water

Since Isoleucine, Methionine and Leucine are non-polar side chains, they are typically found in environments without water, such as the core regions of proteins.

Add a comment
Know the answer?
Add Answer to:
Some amino acids such as Ile, Met, and Leu have nonpolar, aliphatic radical groups, while others...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-

    Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...

  • How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...

    How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu

  • This sequence is RNA because:

    20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...

  • 3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...

    3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...

  • 10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....

    10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...

  • Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...

    Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide...

    please explain each question thoroughly. thanks Question 3: Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr-Leu-Trp-Ala-Ile-His-Phe-Ser-Cys-Lys a. What would happen if this peptide were to be incubated with dinitrofluorobenzene (FDNB) followed by 6M HCl hydrolysis at 1100C for 24 hrs. What labeled product(s) would be detected? Consider the following pepide: What would happen if the peptide were treated with CNBr? What would the products be? Why? b. What would happen if the peptide were treated with chymotrypsin? What would the c. products be? Why? Arg-Cys-Met-Ala-Cys-Gly-Arg-Pro-Asn-Tyr, Leu-Trp, Ala-Ile-His-Phe,...

  • 6. The following polypeptide (30 amino acids) contains a great deal of regular secondary structure. (10)...

    6. The following polypeptide (30 amino acids) contains a great deal of regular secondary structure. (10) (15) (20) lys Lys Ala-Phe-Trp-Met-His- GIh-Thr-lle-Arg-Ser-Gly-Ala-Gly-Ser-Gly-Ala-Trp-Tyr-Pro-Val-Ala (30) Phe-Met-Leu-Val-Pro-Glu-Glu There are at least two regions where alpha helical structure is found. Indicate the beginning and ending residues of these regions. Any group or groups which break the alpha helical structure should not be considered part of the helix. Remember that it take four residues to give a turn of an alpha helix, so that is...

  • The chemical structures of the 20 standard amino acids at pH 7, along with their 3...

    The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT