This question refers to the mRNA sequence below:
5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3'
As this mRNA is translated, the fifth codon is ___. Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
This question refers to the mRNA sequence below: 5' - A G C U G A...
This question refers two mRNA sequences below: a) 5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3' b) 5'-A A C G A A U A U G U U A A U C G U A G C C A C C U G G U U C A G C...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
Listed below is a mature mRNA sequence from a cell. 5’ G C A U G A U G C C U U G G U A A A A 3’ q1) What establishes the reading frame (and thus the beginning of translation)? q2) what would be the amino acid sequence produced using this mRNA sequence as a guide?
For the following sequence: 5’–G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-A-3’ a. What is the sequence of amino acids in the peptide encoded for by the above mRNA? b. Give the sequence of bases in the strand of DNA that resulted in this sequence of mRNA.
The map below was constructed using information from an interrupted mating experiment. Str# refers to the strain number from which the data were obtained. The strains that are referenced by the Str#'s on the map are considered to be strains. The units for the map distance values on this map are Assume that four genes were transferred by each strain in the interrupted mating experiment. Based on this map, list in order of transfer (first to last) the genes transferred...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria. Determine the partial amino acid sequence of the protein coded by this mRNA. Type your answer using one-letter amino acid sequence with no spaces in between and starting with the N terminus. 5'GCCAUCAUGCUAGGAGGUUCACCGGAUGGGGUCACAGACGGCG.......
The image below is a mRNA message.
Please draw a ribosome translating the message below. Draw the
ribosome with P-site ON CODON 3. In your image draw the ribosome
immediately prior to it translocating to the next codon.
It is important to draw tRNAs, amino
acids, etc in the correct location. Do not forget to label all of
the following: A-site (and tRNA), P-site (and tRNA), E-site (and
tRNA), large subunit, small subunit, all amino acids in their
correct positions...
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...