Listed below is a mature mRNA sequence from a cell.
|
5’ |
G |
C |
A |
U |
G |
A |
U |
G |
C |
C |
U |
U |
G |
G |
U |
A |
A |
A |
A |
3’ |
q1) What establishes the reading frame (and thus the beginning of translation)?
q2) what would be the amino acid sequence produced using this mRNA sequence as a guide?
Answer:
q1).
Reading frame strats with AUG codons in mRNA during translation. Therefore, the reading frame is as below. 5- AUGAUGCCUUGGUAA-3'
q2).
|
5’ |
A |
U |
G |
A |
U |
G |
C |
C |
U |
U |
G |
G |
U |
A |
A |
|||||
| Met | Met | Pro | Trp | STOP | ||||||||||||||||
Given the following mRNA sequence, 5'–CGCAAGGCCUAU–3?', answer the questions below. A link to a table of codons can
be found here.
Given the following mRNA sequence, 5'-CGCAAGGCCUAU-3', answer the questions below. A link to aa table of codons can be found here a) What amino acid sequence, using the three-letter designations for amino acids, is coded for by the mRNA? b) If a mutation converts AAG to CAG, what is the amino acid sequence? c) What will the amino acid...
For the following sequence: 5’–G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-A-3’ a. What is the sequence of amino acids in the peptide encoded for by the above mRNA? b. Give the sequence of bases in the strand of DNA that resulted in this sequence of mRNA.
This question refers to the mRNA sequence below: 5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3' As this mRNA is translated, the fifth codon is ___. Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.
The following mRNA sequence is taken from the middle of
exon 3 in a mature mRNA that has many exons, and the mRNA encode 9
amino acids.
Question: Knowing that this mRNA does not have an early
stop codon, which of the reading frames shown is the correct one
for this mRNA? Write down 1, 2, or 3 as your answer. Explain
why?
5'..AGUGAUUCGAUACAGCUAGCGGACAGCUA...3 1 ... Reading frames: Z E hahaha ...hohohoh
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
This question refers two mRNA sequences below: a) 5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3' b) 5'-A A C G A A U A U G U U A A U C G U A G C C A C C U G G U U C A G C...
C++: Translating mRNA sequence help
Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria. Determine the partial amino acid sequence of the protein coded by this mRNA. Type your answer using one-letter amino acid sequence with no spaces in between and starting with the N terminus. 5'GCCAUCAUGCUAGGAGGUUCACCGGAUGGGGUCACAGACGGCG.......