Question

The following mRNA sequence is taken from the middle of exon 3 in a mature mRNA that has many exons, and the mRNA encode 9 amino acids.

Question: Knowing that this mRNA does not have an early stop codon, which of the reading frames shown is the correct one for this mRNA? Write down 1, 2, or 3 as your answer. Explain why?

5..AGUGAUUCGAUACAGCUAGCGGACAGCUA...3 1 ... Reading frames: Z E hahaha ...hohohoh

0 0
Add a comment Improve this question Transcribed image text
Answer #1

3rd frame is correct,

because reading starts from 3' side in mRNA.

all neuclease activity and reading stsrts from 3'side as during translation ribosome starts protien formation by encoding mRNA with the help of tRNA from 3' side

Add a comment
Know the answer?
Add Answer to:
The following mRNA sequence is taken from the middle of exon 3 in a mature mRNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence...

    How many different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met - Leu - Arg? Be sure to include a stop codon. Explain your answer! 5′ ...GGAGCUCGUUGUAUU... 3′ Is this sequence RNA or DNA? How can you tell? Which amino acids are encoded, if the reading frame is as shown, starting from the correct end? What would be the effect on the amino acid sequence if the sequence were changed to 5′ GGAGACUCGUUGUAUU 3′?...

  • BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed...

    BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...

  • Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...

    Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....

  • Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...

    Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...

  • Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass trans...

    why is E the answer Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...

  • 3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...

    3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...

  • Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton...

    Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...

  • Listed below is a mature mRNA sequence from a cell. 5’ G C A U G...

    Listed below is a mature mRNA sequence from a cell. 5’ G C A U G A U G C C U U G G U A A A A 3’ q1) What establishes the reading frame (and thus the beginning of translation)? q2) what would be the amino acid sequence produced using this mRNA sequence as a guide?                                                                                                    

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • 100 300 400 200 A>G 800 500 AGGUA 600 exon 1 Hexon 2 exon 3 700...

    100 300 400 200 A>G 800 500 AGGUA 600 exon 1 Hexon 2 exon 3 700 exon 4 CAG UGA AUG UAA AAAAA Lane: 1 2 3 Lane: 1 2 3 4 5 4 5 approx. size (bp) -900 approx. size (Da) -12,000 -11,000 -800 -700 - 10,000 -600 -9000 -500 -8000 -7000 -400 -300 -6000 Northern Blot Western Blot (fig56) At the top of the figure above is a gene diagram for a hypothetical gene, noting the length of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT