DESIGN PCR PRIMERS (FWD & REV): magnesium: 1.5mM, temp. ideally 60°C, hairpin melting not above 40°C, max Delta G: not over -10, approximately 20-25 letters (?)
>GANP01013062.1_TSA:_Ixodes_ricinus_SigP-154969_mRNA_sequence GATGTGATTTCATCTCAGGGACAGCAACCAGTCTTACCTGGCTTTCCTTCCGGTCCTACTCTCTCTCCTGGAGGACTGGG TCGACCGTGTAGCGTCTACCGCGGTTGCGAGAGCGGCTTGTGCTGCTTATTAACAGGTCGTAGAAATCATGCTGGGGCCA CCTGTCAACCTAAAGGGGGACCCGGAGAGCTGTGCTCAGAGGAGCAAGTCAAGGGTGGCATCTATACTACTTGCTGCCCG TGTCTCAGAGGTCCGTGTCCACCGGGGCGGAGAGCCACGTGA
Forward primer: GAT GTG ATT TCA TCT CAG GGA C
Primer length: 22 bases Melting temperature
:60.2oC Hairpin Tm: 40.2oC
Hairpin
G:-1.71kCal/mol
Reverse primer: TCA CGT GGC TCT CCG C
Primer length: 16 Melting temperature
:63.2oC Hairpin Tm: 33.8oC
Hairpin
G:-0.68kCal/mol (other hairpins formed has a Tm less than this)
The reverse primer is short in order to exclude the GC rich sequence that is increasing the overall Tm of the primer.
the primers are designed using IDT oligoanalyzer
DESIGN PCR PRIMERS (FWD & REV): magnesium: 1.5mM, temp. ideally 60°C, hairpin melting not above 40°C,...
Please show me how they get answer d)
Question B1. Atomic percent magnesium 10 20 30 40 50 60 70 80 90 700 649 1200 1100 -1000 500 900 451 -800 598 67.7 14.9 87.3 400 700 600 500 400 200 100 AI 10 20 30 40 50 60 70 80 90 Mg Weight percent magnesium Figure 1: Aluminium-Magnesium equilibrium phase diagram. (Source: Metals Handbook, 8th Edition. Vol 8 American Society for Metals p. 261.) Consider an Al-7 wt% Mg...
QUESTIONS Nameplate Information 50 horsepower O Three phase a Insulation class: F O 1.15 service factor ロ Max amb temp: 40 °C 1765 rpm O NEMA 326T frame NEMA code: G 208-230/460 v O NEMA design: B O 140-122/61 A o Time rating: NEMA norm eff: 92.4% NEMA min eff: 91.0% continuous for an AC induction motor, determine the nameplate (rated) motor torque (in N.m) that the machine can provide. Assume the machine will be operated Given the where the...
Question 1 A turning operation is carried out on aluminum. Based on the specific energy values in Table 20.2, determine material removal rate and cutting power in the operation under the following sets of cutting conditions: (a) Cutting speed 5.6 m/s, feed 0.25 mm/rev, and depth of cut 2.0 mm; and (b) cutting speed- 1.3 m/s, feed 0.75 mm/rev, and depth 4.0 mm. Question 2 Consider a turning operation performed on steel whose hardness 225 HB at a cutting speed...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
i need help with the postlab questions please
Grignard reagent THE GRIGNARD REAGENT-PREPARATION AND REACTION In this experiment, you will prepare a Grignard reagent, phenyl magnesium bromide, from bromobenzene and magnesium metal. The Grignard reagent will then react with methyl benzoate to form triphenylmethanol. Introduction Grignard reagents, such as organomagnesium halides, were discovered in 1910 by French chemist Victor Grignard. The Grignard reaction is one of the most general methods for carbon- carbon bond formation in all of organic chemistry....
please find the purpse, Discussion, conclusion
un 27 Phoenix June 20 8:10 PM a 35AEXPERIMENT 35A Triphenylmethanol PROCEDURE ether MgBr+ C-OH + MgBr(OH) OMgBr 0 Addct Addition of Benzophenone While the phenylmagnesium bromide solution is being heated and stirred under reflux, make a solution of 1.09 g benzophenone in 2 mL of anhrudrous ether in a 5-mL conical vial. Cap the vial until the reflux period is over. Once the Grignard reagent is cooled to room temperature, draw some of...
1. Which of the following are the sites within the human body where carbon dioxide and oxygen are exchanged? A. Alveoli B. Arteries C. Synapses D. Venules 2. Which of the following describes the most important reason for repeating an experimental investigation? A. To verify the validity of the original findings B. To expand upon the original investigation C. To manipulate the independent variable D. To attempt to disprove the hypothesis 3. Lithium has an atomic number of 3 and...
10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated sludge operation that adversely affect effluent quality with origins in the engineering, hydraulic and microbiological components of the process. The real "heart" of the activated sludge system is the development and maintenance of a mixed microbial culture (activated sludge) that treats wastewater and which can be managed. One definition of a wastewater treatment plant operator is a "bug farmer", one who controls the aeration...