Question

Background Information How can we predict where a coding gene will be in bacteria? And can...

Background Information

How can we predict where a coding gene will be in bacteria? And can we then predict what protein will be produced?

Take the DNA sequence below, for example.

tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct

If you were a bacterial RNA polymerase, what sequence(s) should there be in this DNA for you to bind and begin transcribing? And if you found such sequence(s), where would you begin transcription? As a human being looking at this fragment of DNA, what type of consensus sequence(s) would you look for, and where would you place the TSS (or +1)?

Let's then assume that transcription begins...
... where will it end? Remember that these are bacteria and that they will have a termination sequence. Can you see it?

As a researcher, if you found the sequence(s) that you would normally find in a bacterial core promoter and a strong termination signal, then there would be a good chance that you are indeed in front of a functional gene that will be transcribed into RNA. How would you now determine if the bacteria will try to translate this RNA? In other words, how would you determine if the transcribed RNA is actually a messenger RNA (mRNA)? What kind of sequence does a bacterial mRNA need to be bound and translated by ribosomes?

Finally, if you determine that the above DNA indeed coded for a functional mRNA, what would be the protein produced from it? What would you (or a ribosome) look for to determine where to begin and proceed with translation? Where will translation stop? And what would be the polypeptide produced?

Instructions

Your job now is to copy the above DNA sequence and highlight each of the different sequence elements that are relevant to this particular gene (I suggest that you use different font backgrounds for each sequence element) and briefly explain what each of them do . Then, write the sequence of the mRNA that would be transcribed from this DNA sequence, identifying the AUG and STOP codon (I suggest that you bold and underline text this time).

Once you've established the protein coding sequence in your mRNA, use any of the gazillion free online protein translators to upload the sequence of nucleotides between the AUG and the STOP codons to translate the nucleotide sequence into amino acid sequence (Note: I do not mean genetic code tables that you may find online - I literally mean online translators in which you can upload a sequence of nucleotides starting with AUG, and obtain the predicted sequence of amino acids that would be translated from them). Finally, write the expected polypeptide sequence using one letter amino acid notation (A for alanine, W for tryptophan, etc).

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The first step is to find closely-related genomes to a given bacterial genome. The second step is to extract intergenic regions among the selected genomes and to apply the BLAST program to compare intergenic regions pair wisely.Once you have the software, one of the commands is to make your own BLAST database - you can use either the genome sequence of quail (in a FASTA file) or a file of all the CDS from quail, to make your database.
Once you have the database made you can use the local BLAST command to search for the chicken protein sequence in the quail genome, using the tBLASTn function.
RNA polymerase binds to a sequence of DNA called the promoter, found near the beginning of a gene. Each gene (or group of co-transcribed genes, in bacteria) has its own promoter. Once bound, RNA polymerase separates the DNA strands, providing the single-stranded template needed for transcription.

Add a comment
Know the answer?
Add Answer to:
Background Information How can we predict where a coding gene will be in bacteria? And can...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcg

    tcaggctttaattcatccgtgatctttgacgacggtaaatacgatgcagatataatacgatgaccgatgccaatcgaccgatcaaggaggcaccgaatggcgatgatggcgatgattgcgattaacgaagtggaacgcattatggcgggcattaacgaagatacccatgcgaccggcgaaaacgaaaccatttgcagctgcgcgaactttgaagaactgacccatgcgaccggccgcgaagcgacctaaaagtcgtaattacgtatcaagtcatgggccgcgggcgcccggcccactgactagactagggccgggcgcccgcggcccaccatataaataaaaaaaaaaaaaacgaggctatagctcatcaatgacct Your job now is to copy the above DNA sequence and highlight each of the different sequence elements that are relevant to this particular gene (I suggest that you use different font backgrounds for each sequence element) and briefly explain what each of them do . Then, write the sequence of the mRNA that would be transcribed from this DNA sequence, identifying the AUG and STOP codon (I suggest that you bold and underline text this time). Once you've...

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • You are given a DNA sequence that codes for a short polypeptide,    TACGCTAGGCGATTGACT. What would be...

    You are given a DNA sequence that codes for a short polypeptide,    TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? state the amino acid sequence of the polypeptide translated from this mRNA.

  • Can anyone explain these answers step by step. Especially I do not know how to start...

    Can anyone explain these answers step by step. Especially I do not know how to start question 1 or two!!! Thank you! Work with a partner to complete the following questions. 1. Fill in the bases of the complementary DNA strand. 3-TATAATTACGCTAGATCACCCACT5 2. Transcribe the mRNA sequence using the bottom (3 to 5) strand as the template. What is the name of the sequence upstream of the gene that the RNA polymerase binds to? 3. 4. What polypeptide sequence would...

  • want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the...

    want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...

  • 11. A gene is best defined as a. A segment of DNA b. Three nucleotides that...

    11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • Question 2 Imagine you are a scientist who intends to cure sickle cell disease. Which approach...

    Question 2 Imagine you are a scientist who intends to cure sickle cell disease. Which approach would be best suited to this goal? a. Dietary supplements to make up for an enzyme deficiency b. Modification of ribosomes to enhance translation c. Exposure to X-rays to induce a new mutation d. Dietary supplements to make up for an amino acid deficiency e. Editing the gene for a polypeptide component of hemoglobin Question 7 Stop codons terminate translation by a. increasing peptidyl...

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons...

    QUESTION 7 Consider the hypothetical gene show here. The gene coding sequence consists of 4 exons (shown in solid colors). The 5' UTR and 3' UTR are shown as striped boxes. 25 150 200 300 400 25 Based on the lengths of the exons, you should be able to calculate a rough estimate of the protein encoded by this gene, assuming that all 4 exons are translated and the protein does not undergo any significant processing (cleavage or chemical modifications)....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT