Question

You are given a DNA sequence that codes for a short polypeptide,    TACGCTAGGCGATTGACT. What would be...

You are given a DNA sequence that codes for a short polypeptide,    TACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? state the amino acid sequence of the polypeptide translated from this mRNA.

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
You are given a DNA sequence that codes for a short polypeptide,    TACGCTAGGCGATTGACT. What would be...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • every question 12. What are the 3 types of RNA? What is th NA? What is...

    every question 12. What are the 3 types of RNA? What is th NA? What is the role of each of them in translation Briefly describe what happens during the steps of translation 1. Initiation of translation 2. Elongation 3. Termination of translation 14. The base sequence of the gene coding for a short polypeptide is the following TACGCT AGGCGATTGACT A. What would be the base sequence of the mRNA transcribed from this gene? B. Using the genetic code given...

  • 12-16 LUIS 15 12. What are the 3 types of RNA? What is the role of...

    12-16 LUIS 15 12. What are the 3 types of RNA? What is the role of each of them in translation? 13. Briefly describe what happens during the steps of translation 1. Initiation of translation 2. Elongation 3. Termination of translation 14. The base sequence of the gene coding for a short polypeptide is the following: TA CGC TAGGCGATTGACT A. What would be the base sequence of the mRNA transcribed from this gene? B. Using the genetic code given out...

  • The base sequence of a polynucletide chain is given as follows: 3'-TAC GGG CTA CAA CTT...

    The base sequence of a polynucletide chain is given as follows: 3'-TAC GGG CTA CAA CTT AAC AGA CCA ATC-5' what will be produced if this DNA molecule is replicated. the answer should either be the nitrogeneous base sequence of nucleotide chain or amino acid sequence of peptide chain.if the answer is nitrogeneous base sequenceof peptide chain, label the ends of it (5'and 3') what is the amino acid sequenceof the polypeptide chain that will be synthesized according to the...

  • This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would:...

    This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...

  • 3. Below is the template DNA sequence for a short human protein: Template DNA = 3’...

    3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.

  • A strand of DNA has the base sequence GATTCA

    3. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. 5'-G A T T C A-3' 4. List the steps (and the major enzymes in each step) involved in DNA replication: 5. In what direction is a new DNA strand formed?6. Define the following terms: a. Transcription b. Translation: 7. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence 5'-G CCATATTG-3' 8. For each of the following...

  • 6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...

    6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA?...

    QUESTION 33 What amino acid sequence would be found in the polypeptide produced from this mRNA? Follow the normal rules for gene expression 5-AGCAAUAUGGCGAUUCGCUGAGUACCU-3 SecondA base UUS Ty UCC UGA CCU CAU CUC CCC First RNA beweisend) Third CO DO CODO<O> RNA base and GU AC U

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT