Prompt:
Product Position - Primer can be located near the 5' end, the 3' end or any where within specified length. Generally, the sequence close to the 3' end is known with greater confidence and hence preferred most frequently.
Question:
Why is it that the sequence close to the 3' is preferred?
GC content : The GC content ( the number of G's and C's in the primer as a percentage of the total bases ) of primer bases should be more than 60%
GC clamp : The presence of G or C bases within the last 5 bases from the 3' end of the primers helps promote specific binding at the 3' end due to the stronger bonding of G and C bases . More than 3 G's or C's should be avoided in the last 5 bases at the 3' end of the primer.
Hence by considering this reason the sequence close to the 3' end is preferred.
Prompt: Product Position - Primer can be located near the 5' end, the 3' end or...
import java.util.Arrays; import java.util.Random; import java.util.Scanner; /** * TODO Write a summary of the role of this class in the * MasterMind program. * * @author TODO add your name here */ public class MasterMind { /** * Prompts the user for a value by displaying prompt. * Note: This method should not add a new line to the output of prompt. * * After prompting the user, the method will consume an entire * line of input while reading...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
Please note that Questions 15 to 17 are connected
questions.
Question 15:
The following shows a partial DNA sequence from the wild-type
(normal) allele for the human leukemia-linked apoptotic
gene.
5' ATGCGATTAATCGGTAAA 3' (non-template strand)
3' TACGCTAATTAGCCATTT 5' (template strand)
Please answer the following questions:
(a) If the bottom strand serves as the DNA template for
transcription, what is the resulting mRNA sequence?
The mRNA sequence is 5' 3'. (2
marks)
5' AUG CGA UUA AUC GGU AAA 3' ?
Please enter...
General instructions Please answer each question as thoroughly, but concisely, as you can, making reference as much as possible to Business Law concepts ? Multiple Possibilities. Some questions will have more than one possible outcome; in such cases you should describe each possible outcome and the factor(s) that would determine which possible outcome would occur. ? Missing Information. If there is any information that is missing that you believe is relevant to your analysis or conclusion, identify what that missing...
This assignment is comprised of 3 parts: All files needed are located at the end of the directions. Part 1: Implementation of Dynamic Array, Stack, and Bag First, complete the Worksheets 14 (Dynamic Array), 15 (Dynamic Array Amortized Execution Time Analysis), 16 (Dynamic Array Stack), and 21 (Dynamic Array Bag). These worksheets will get you started on the implementations, but you will NOT turn them in. Do Not Worry about these, they are completed. Next, complete the dynamic array and...
Project 4: Month-end Sales Report with array and validation Input dialog box for initial user prompt with good data and after invalid data Input OK Cancel Input dialog boxes with sample input for Property 1 Ingut X Input Enter the address for Property 1 Enter the value of Property 1: OK Cancel Input dialog boxes after invalid data entered for Property 1 Error Please enter anmumber greater than D Ester the walue of Peoperty t Console output END SALES REPORT...
check the mission and vision statements in the image
uploaded.
1. Is the vision statement effective? Justify your answer
referring to checked characteristics of effective vision
statement.
2. Is the mission statement effective? Justify your answer
referring to checked characteristics of effective mission
statement.
3. How are core values of chosen organisation reflected in its
vision and mission statements?
using the following characteristics for evaluation of mission
and vision statements: (First picture for mission, second picture
for vision)
VISION To...
As a new graduate, you have taken a management position with Exotic Cuisines, Inc., a restaurant chain that just went public last year. The company’s restaurants specialize in exotic main dishes, using ingredients such as alligator, buffalo, and ostrich. A concern you had going in was that the restaurant business is very risky. However, after some due diligence, you discovered a common misperception about the restaurant industry. It is widely thought that 90 percent of new restaurants close within three...
Procedure: Materials: 1. apparatus 2. 2 pieces of metal track 3. plastic or metal ball 4. timer 5. meter stick 6. micrometer 7. 2 photogates Assemble your ramp as shown in Figure (1) in the next page. Then set up photogates in location 2 and 3. Measure the diameter (in m) of the metal balls (you will need it for speed calculations). Then, measure the weight (mass) of the ball (in kg). To have a better measurement of the time,...
Page 256 - Writing Prompt: Ethical Framework for Hostile Takeovers In view of Maxxam's takeover of Pacific Lumber, do you believe that hostile takeovers are morally wrong, or could they be morally permissible or even desirable in certain circumstances? What do you think is the most important ethical objection to hostile takeovers? Explain your reasoning. Provide no less than 1 full page response to the above questions and answer each question as a separate paragraph. I want to assess your...