Question

10. Describe what is meant by a) RNA capping and b) Polyadenylation . 11. Describe the...

10. Describe what is meant by a) RNA capping and b) Polyadenylation

.

11. Describe the process of RNA splicing. Please include what the role of the spliceosome, snRNAs and alternative splicing.

12. A prokaryotic RNA may contain many AUG codons. How does the ribosome distinguish AUG codons specifying initiation from AUG codons specifying internal methionine?

13. How does each tRNA molecule recognize the one amino acid in 20 that is its proper partner? Please explain and include in your answer what an ‘anticodon’ is.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

10. (a) Following transcription in the nucleus, a 7-methyl guanosine cap is added to the resulting transcript for protection against exonucleases. The cap also facilitates splicing events and translation. The process is catalyzed by Capping enzyme.

(b) Polyadenylation is the process of addition of Poly(A) tail to the 3' end of the transcript following transcription in the nucleus. The process is catalyzed by Poly(A) polymerase and reaches an average length of 250 nucleotides.

(Since there are multiple questions, the first full question have been answered according to the rules of Chegg)

Add a comment
Know the answer?
Add Answer to:
10. Describe what is meant by a) RNA capping and b) Polyadenylation . 11. Describe the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core...

    Describe the structure and function of elements needed for transcription, including the promoter, RNA polymerase core enzyme and holoenzyme, sigma factor, and template and non-template (coding) strands of DNA. eukaryotes - . List major differences between transcription and RNA processing in bacteria and o What is coupled transcription/translation? o What is a polyribosome? Is it exclusive of bacterz - Discuss major components and events in RNA processing, in - Describe tRNA stru - Discuss mech cluding, introns and exons, splicing....

  • 3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct...

    3.  What are the “translator” molecules that recognize a codon in the mRNA and deliver the correct amino acid? 6. If each amino acid was encoded by a single codon, what is the minimum number of amino-acyl tRNA synthetases required for translation? 7. Looking at the codon table, if there was a unique aminoacyl-tRNA synthetase required for each anticodon, what is the minimum required? 9. If an aminoacyl-tRNA synthetase recognized any nucleotide (purine or pyrimidine) in the 5’end of the anticodon,...

  • PLease do 19-21 Question 18 Which of the following will most likely be observed if the...

    PLease do 19-21 Question 18 Which of the following will most likely be observed if the spliceosome were to be inactivated? A decrease in the formation of 2 to 5 phosphodiester bonds. An increase in the formation of RNA lariats. An increase in the number of RNAs produced by alternative splicing. O A decrease in 7mGppp formation Question 19 Which of the following is NOT true of typical aminoacyl tRNA synthetases? They catalyze the formation of a larger molecule. They...

  • QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...

    QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process...

    pls fo all 20) A) an enzyme that synthesizes RNA as part of the transcription process B) an enzyme that uses RNA as a substrate C) an enzyme that catalyzes the association between the large and small ribosomal subunits D) an enzyme that synthesizes RNA primers during DNA replication E) an RNA with enzymatic activity 20) What is a ribozyme? 21) 21) Alternative RN A splicing A) increases the rate of transcription. B) can allow the production of similar proteins...

  • 1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the...

    1. Describe the differences between prokaryotic and eukaryotic translation initiation. How does the ribosome find the correct start codon and what proteins are involved in the process? please include the shine-dalgarno sequence in the answer. 2. Consider the following partial sequence of messenger RNA. The sequence below contains the code for a short, complete protein. 5 ́-UCCCCAGUCAUGGAGUCGUUAAUUAAAUGACCGGUGCGGAUCGUA - 3 ́ Using the codon chart (from your textbook or in the lecture slides), give the amino acid sequence of the protein...

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • 1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What...

    1. (6 pts.) The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 2. (4 pts.) Describe the difference between cotranslational and post translational protein localization. Be specific-a well-labeled diagram could help. 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the-10 and the -35 sites and RNA polymerase plus sigma factor. 4. (4 pts.) Describe in detail the movement of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT