Question

A) Which property of DNA replication enables accurate mismatch repair to prevent mutation? a) Adenine methylase...

A) Which property of DNA replication enables accurate mismatch repair to prevent mutation?

a) Adenine methylase lags behind the DNA polymerase

b) the proofreading ability of DNA polymerase

c) the error-free nature of DNA pol. III

d) the sister chromatid can be used as a template

B) which DNA repair mechanism uses the sister chromatid as a template for repair?

a) nucleotide excision repair

b) double-stranded break repair

c) postreplication repair

d) base excision repair

C) indicate which substitutions require one or more than one mutation

Val to ala

Leu to Gly

His to glu

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans-A- DNA polymerase has 3' to 5' exonuclease activity which repairs the mismatch when ever any wrong nucleotide is added by mistake. Option B is correct.

Ans-B- sister chromtids are used as a template when both the strand of DNA are damage. So the information needed to repair the DNA strand is taken from sister chromtids. Option B is correct.

Ans-C- if we want to substitute one amino acid from other amino acid minimum one substitution is required in DNA bases. Val to ala substitution require only one mutation while Leu to gly and His to glu requires two mutation. Hence all requires minimum one mutation.

Add a comment
Know the answer?
Add Answer to:
A) Which property of DNA replication enables accurate mismatch repair to prevent mutation? a) Adenine methylase...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 21. In DNA replication, new nucleotides are added a. To the 5' end of each nascent...

    21. In DNA replication, new nucleotides are added a. To the 5' end of each nascent strand b. To the 3'end of each nascent strand To both ends of each nascent strand d. To the 5' end of the continuous strand and the 3' end of the discontinuous strand e. To the end of the continuous strand and the end of discontinuous strand fragments 22. DNA unwinding is done by a. Ligase b. Helicase c. Topoisomerase dHexonuclease 23. Proofreading of...

  • 1)Repairing damaged DNA is essential to maintaining the integrity of the genome. One type of repair...

    1)Repairing damaged DNA is essential to maintaining the integrity of the genome. One type of repair is known as nucleotide excision repair. In this system, which order do the necessary enzymes act? A) exonuclease, DNA polymerase III, RNA primase B) helicase, DNA polymerase I, DNA ligase C) DNA ligase, nuclease, helicase D) DNA polymerase I, DNA polymerase III, DNA ligase E) endonuclease, DNA polymerase II, DNA ligase 2) What might be the result if all cells had functioning telomerase? A)...

  • 1. In eukaryotes, which DNA polymerase is primarily responsible for filling in the gaps in the...

    1. In eukaryotes, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during base excision repair?   DNA polymerase α DNA polymerase β DNA polymerase γ DNA polymerase ö DNA polymerase μ 2. High energy electromagnetic radiation includes which of the following?   ultraviolet light x-rays gamma rays two of the above all three of the above 3. Which of the following types of damage to DNA cannot be caused by x-rays and gamma rays?   deletions...

  • 1.Which of the following DNA repair systems involving DNA N-glycosylasesrecognizes an abnormal DNA nucleotide (i.e. uracil)...

    1.Which of the following DNA repair systems involving DNA N-glycosylasesrecognizes an abnormal DNA nucleotide (i.e. uracil) and cleaves the bond between it and the sugar? - Mismatch repair -Base excision repair -Non-homologous end-joining repair -Homologous recombination repair 2. self-splicing is the most common mechanism for splicing mRNA transcribed from eukaryotic, nuclear, structural genes - true or false 3. True or False, during elongation of transcription, RNA polymerase is primarily in a closed complex

  • Match the following phenotypes with the mutation that would be the most likely to be its...

    Match the following phenotypes with the mutation that would be the most likely to be its cause. The mutant proteins are listed below, followed by the protein domain that is mutated in each case, followed by the amino acid change that is a result of the mutation Try to answer each question by using the following reasoning: if you observe a phenotype, then that could be due to a mutation in protein in which the domain has had an amino...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • describe how the Methyl-directed mismatch repair system in E. coli which DNA strand is the correct...

    describe how the Methyl-directed mismatch repair system in E. coli which DNA strand is the correct strand and determines which DNA strand has the mutation. describe how DNA methylation is heritable during replication how epigenetic modifications are involved in genomic imprinting, X-inactivation, and regulation of tissue/cell specific gene expression (including the general roles of TrxG and PcG group proteins). ***Are these heritable during mitosis or meiosis? Are these reversible? Can you support your answer?

  • QUESTION 3 The codon S-AUG-3' on an mRNA encodes the amino acid methionine. What is the...

    QUESTION 3 The codon S-AUG-3' on an mRNA encodes the amino acid methionine. What is the corresponding anticodon found on the methionine charged tRNA? 3-UAC-5 5-UAC-3 o 3-GUA-5 5'-ATG-3 QUESTION 4 Match each cause of DNA damage with the mechanism by which it can lead to mutations. Topoisomerase is unable to function properly, and when it makes A cuts in the DNA strands these are not always repaired. This leads to a loss of nucleotides and potential frameshift mutations. In...

  • 16. Which of the following enzymes adds DNA to the ends or material with duplication? a....

    16. Which of the following enzymes adds DNA to the ends or material with duplication? a. Telomerase b. Polymerase d. Primase e. Ligase 1. Which of the following structures indicates where DNA replication begins a. DNA polymerase III b. Replication fork C. Helicase d. Origin of replication e. Centromeres 18. A select mutation is causing a cell lineape to be unable to replicate DNA SUccessfully NA successfully. When observed under a microscope, researchers observe that the DNA is able to...

  • 3P Question 19 Which of the following process(es) require DNA ligase function? Replication during S phase...

    3P Question 19 Which of the following process(es) require DNA ligase function? Replication during S phase Recombination All of these require DNA ligases Nucleotide excision repair Base excision repair Question 20 3 pts The reason that genes on different chromosomes separate independently from each other is that: Different alleles of one gene separate into different daughter cells during melosis 1 Linked genes segregate independently of each other during melosis Alleles of one gene separate during Melosis il Sister chromatids separate...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT