Question

Question 6: In the process of transcription, one of the DNA strands used is known as...

Question 6:
In the process of transcription, one of the DNA strands used is known as the template strand. The other, nontemplate strand is often referred to as the coding strand. Why do each of these names make sense? (i.e. What is the template strand a template for? What does the coding strand code for?) Lastly, how does this situation compare to the process of DNA replication? (i.e. What do we call the two strands in that case?)
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The strand of DNA from which the mRNA is synthesized is known as the template strand or anti-sense strand.This strand is in the 3' to 5'direction.This strand provides the template for RNA synthesis.
The strand of DNA which contains the base sequence which corresponds to the sequence of bases in the RNA transcript where only thymine is substituted with uracil.This strand runs in the 5'to 3'direction is known as the sense strand.The information is same as in the coding strand of DNA and RNA transcript(only U in place of T).

In DNA replication,there are two DNA strands and both the strands serve as the templates for the replication.The parent strand known the leading strand is replicated in the 3' to 5' direction and it is a continuous process.The other parent strand known as the lagging strand is replicated in the 5' to 5' direction and it is not a continuous process and takes place in smaller fragments.

Add a comment
Know the answer?
Add Answer to:
Question 6: In the process of transcription, one of the DNA strands used is known as...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription -...

    What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription - Eukaryotes What serves as the template? Unwinding of DNA Initiation Elongation What direction does elongation occur? Termination What is the end product of this process? How many strands? Processing after?

  • DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the...

    DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the complementary nucleotides into place ONE AT A TIME, beginning at the end of each strand as shown in the photo 7. Compare the base sequences in the strands of these two new DNA molecules with each other, and also with the original strand. Are they identical molecules? 8. Point to the two strands of the original DNA molecule. Note that an original strand represents...

  • 15. The term that describes the directionality of the two strands in DNA Is A antidirectional...

    15. The term that describes the directionality of the two strands in DNA Is A antidirectional B polydirectional Csemiparallel D. antiparallel E ntisequencial 16. Which of the following enzymes synthesis new DNA during DNA replication? ADNA primase B. RNA polymerase CONA polymerase D Helicase E DNA ligase 17. Which of the following enzymes generates a covalent bond between Okazaki fragments? A DNA primase B. RNA polymerase C DNA polymerase D Helicase E. DNA ligase strand. 18. During DNA replication Okazaki...

  • Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...

    Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • 1a. What is the basis for the difference in how the leading and lagging strands of...

    1a. What is the basis for the difference in how the leading and lagging strands of DNA molecules are synthesized? a. the orgins of replication occur only at the 5' end b. DNA ligase works only in the 3'->5' direction c. helicases are single stranded binding proteins work at the 5' end d. DNA polymerase can join new nucleotides only to the 3' end and of a preexisted strand, and the strand are antiparallel. ------------------------------------------------------------------------------------------------------------------------------------------- 1b. DNA polymerase; a. do...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT