You want to digest the phage genomic DNA you just isolated with a restriction enzyme called HaeIII. You find the enzyme and a 10X stock of HaeIII enzyme buffer in the freezer. How much buffer will you add if the total volume of your reaction is 50 microliters?
Answer: 5 microliters of the 10 X HaeIII enzyme buffer is need to be added in a 50 microliter total reaction volume, to get a final buffer concentration of 1 X as a working buffer concentration. HaeIII recognize GGCC and produce blunt ends,
You want to digest the phage genomic DNA you just isolated with a restriction enzyme called...
Suppose you are going to do a restriction digest with a plasmid, using the restriction enzyme Eco R1. A map of the plasmid is shown here. The entire plasmid is 6000 bp, and there are Eco R1 restriction sites at 1500 bp, 2000 bp, and 4000 bp. You’re going to run the entire volume of the digest on a gel, and you want to cut just enough DNA to have 50 ng in the smallest band on your gel. Starting...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
You are preparing to clone a DNA fragment into a plasmid vector. You start by linearizing your plasmid (concentration = 500 ng/μl) with EcoRI, which is provided in a standard 50% glycerol solution at 10 units/μl. Your enzyme also comes with an appropriate 10X reaction buffer. Taking into account the final allowable glycerol concentration, you want to add the maximum amount of EcoRI, to achieve complete digestion of 1 μg plasmid DNA in a total volume of 20 μl. Fill...
How are we getting the volumes in this solution for example
for 10Xs buffer how did we get 1 microliter please explain for each
reagent how the microliters were obtained; ddH20, 10X buffer A, 1
microgram/microliter DNA stock, and enzyme at 10
U/microliter.
Question: What is the most concentrated stock of buffer A you can make? Now if you want to prepare an enzymatic reaction containing 1X buffer A, 100 ng/ul DNA stock and 1 Unit/ul (U/ul) of enzyme proceed...
How are we getting the volumes in this solution for example
for 10Xs buffer how did we get 1 microliter please explain for each
reagent how the microliters were obtained; ddH20, 10X buffer A, 1
microgram/microliter DNA stock, and enzyme at 10
U/microliter.
Question: What is the most concentrated stock of buffer A you can make? Now if you want to prepare an enzymatic reaction containing 1X buffer A, 100 ng/ul DNA stock and 1 Unit/ul (U/ul) of enzyme proceed...
7. You purify DNA from a miniprep and wis units/ml (1 unit = 1 hg of DNA digested per hour u to ensure complete digestion), 5X reaction butter, (b-e) to calculate how to prepare a restriction enzym a. Using the A260, what is the DNA's concentration? na miniprep and wish to digest it with EcoRI. You have DNA with an A260 of 2.0, EcoRI at digested per hour under optimal conditions, but 10 units are usually used per reaction "...
The composition of a 10X restriction enzyme buffer us: 500mM Potassium Acetate; 200 mM Tris-acetate; 100mM Mg Acetate; 1 mg/ml BSA. a) If you set up a reaction with 25 uL final volume, what volume of 10X buffer would you add to obtain 1X? b) In reference to the above, what is the final concentration of BSA in the 25 uL reaction?
3. (2 pts.) You are sequencing the end of a genomic DNA fragment that was cut with the restriction enzyme BamH1 and ligated into a plasmid that was also cut with BamH1. You have denatured the DNA and annealed a labeled primer to plasmid sequences adjacent t<o the insertion site as shown below: 3' BamHi 5' GATCTAGCTAGCTAGCTAGCTAGCTAGCTAGCCATCGATGCTAGGAATCTTTGCTGATGCTAGTCGATGCCGTAGC ACTACGATCAGCTACGGC 3' 18 base primer 5' Next you add DNA polymerase, buffer, an excess of all four dNTPs, and a small amount of...
If you were setting up a 20μl restriction digest, how much of the 5X buffer would you use? a. 2.0 μl b. 4.0 μl c. 16 μl d. 5 times the volume of restriction endonuclease used.
Question 6 Using stock solutions to make up a solution: from final concentration to volume You need to digest a sample of DNA with a restriction enzyme. You will do this reaction later in the semester. The buffer for this reaction has a final concentration of 40 mM Tris, pH 7.5, 10 mM MgCl2 and 50 mM KCl. You have the following stock solutions: 0.5 M Tris, pH 7.5, 1 M MgCl2 and 2 M KCl. How would you make...