Question

Go to NCBI BLAST search web page 1st search: GEKDLRRAKDINQEVYNF 2nd search: PTSQRLQLLEPFDK 3rd search: GEKDLRRAKDINQEVYNF...

Go to NCBI BLAST search web page

1st search: GEKDLRRAKDINQEVYNF

2nd search: PTSQRLQLLEPFDK

3rd search: GEKDLRRAKDINQEVYNF PTSQRLQLLEPFDK

4th search: PTSQRLQLLEPFDK GEKDLRRAKDINQEVYNF

5th search: FNYVEQNIDKARRLDKEG

Identify the unknown protein using these 5 searches

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The below protein sequences are done through protein- protein BLAST in the  NCBI BLAST search web page

1st search: GEKDLRRAKDINQEVYNF

2nd search: PTSQRLQLLEPFDK

3rd search: GEKDLRRAKDINQEVYNF PTSQRLQLLEPFDK

4th search: PTSQRLQLLEPFDK GEKDLRRAKDINQEVYNF

5th search: FNYVEQNIDKARRLDKEG

The 5th search from the web page does not contain any putative conservative domians related to this sequences. Hence it is concluded that the protein  sequence 5th search  FNYVEQNIDKARRLDKEG is unknown protein.

Add a comment
Know the answer?
Add Answer to:
Go to NCBI BLAST search web page 1st search: GEKDLRRAKDINQEVYNF 2nd search: PTSQRLQLLEPFDK 3rd search: GEKDLRRAKDINQEVYNF...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 21. A professor wants to award prizes for 1st, 2nd, 3rd, 4th and 5th in the...

    21. A professor wants to award prizes for 1st, 2nd, 3rd, 4th and 5th in the class of 30. In how many ways can the prizes be awarded (assume no two students tie)?

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • Hame manual transmission: 1st-3.24, 2nd - 2.10, 3rd - 1.42, 4th - 1.00, 5th - 0.81...

    Hame manual transmission: 1st-3.24, 2nd - 2.10, 3rd - 1.42, 4th - 1.00, 5th - 0.81 and 6th - 0.62. The differential has a ratio of 3.55:1 (the tire spins slower than the output of the transmission). The rear tire radius is 13.63 inches and the engine's maximum speed is 7500rpm. If the car is travelling at 105mph, what is the lowest selectable gear by number and corresponding engine speed? A 2018 Mustang GT has the following gear ratios in...

  • dropdowns 1st - downward or upward 2nd - more or less 3rd - increase or decrease...

    dropdowns 1st - downward or upward 2nd - more or less 3rd - increase or decrease 4th - fall or rise 5th - bid up or not affect or reduce For simplicity, assume that the supply of labor is not affected by real wages and is therefore a vertical line. An increase in capital shifts the production function because V output can be produced from the same amount of labor. V their demand for labor because the marginal benefit from...

  • Rank these bonds in order of increasing percent ionic character: 1st choice HO 2nd choice AIS...

    Rank these bonds in order of increasing percent ionic character: 1st choice HO 2nd choice AIS 3rd choice KCI 4th choice LiF 5th choice AsBr

  • Rank the protein value of grass, forbs, and shrubs. 1st 2nd 3rd Explain and give examples...

    Rank the protein value of grass, forbs, and shrubs. 1st 2nd 3rd Explain and give examples of feeding programs for horses.

  • Units to be produced 1st Quarter 12,000 2nd Quarter 15,000 3rd Quarter 14,000 4th Quarter 13,000...

    Units to be produced 1st Quarter 12,000 2nd Quarter 15,000 3rd Quarter 14,000 4th Quarter 13,000 In addition, 15,000 grams of raw materials inventory is on hand at the start of the 1st Quarter and the beginning accounts payable for the 1st Quarter is $6,200. Each unit requires 5 grams of raw material that costs $1.80 per gram. Management desires to end each quarter with an inventory of raw materials equal to 25% of the following quarter's production needs. The...

  • A company expects the following sales for the coming year: 1st Quarter 2nd Quarter 3rd Quarter...

    A company expects the following sales for the coming year: 1st Quarter 2nd Quarter 3rd Quarter 4th Quarter Units 50,000 40,000 70,000 90,000 Average selling price $6 $6 $6 $8 Budgeted sales revenue for the year is: a.$1,680,000. b.$1,155,000. c.$1,050,000. d.$1,260,000. e.It is impossible to tell from this information.

  • Element J was found to have the following ionization energies (in kJ/mol) 1st IE 2nd IE...

    Element J was found to have the following ionization energies (in kJ/mol) 1st IE 2nd IE 3rd IE 4th IE 5th IE 6th IE 631 1235 2389 7099 8844 10720 How many valence electrons does element J have? Explain. (2) If element J is found in the fourth period, identify element J. (1) Write the electronic configuration for element J. (1) Write complete sets of quantum numbers for each of the valence electrons (i.e. n, l, and ml) that you...

  • 1st Quarter 2nd Quarter 3rd Quarter 4th Quarter 31,000 33,000 24,000 29,000 Budgeted unit sales The...

    1st Quarter 2nd Quarter 3rd Quarter 4th Quarter 31,000 33,000 24,000 29,000 Budgeted unit sales The company's variable selling and administrative expense per unit is $3.00. Fixed selling and administrative expenses include advertising expenses of $8,000 per quarter, executive salaries of $50,000 per quarter, and depreciation of $30,000 per quarter. In addition, the company will make insurance payments of $5,000 in the first quarter and $5,000 in the third quarter. Finally, property taxes of $7,000 will be paid in the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT