A mutation in a gene(brca1)that causes breast cancer has been identified in a)chromosome2 b)chromosome10 c)chromosome12 d)chromosome17
A mutation in a gene(brca1)that causes breast cancer has been identified in
a)chromosome2 b)chromosome10 c)chromosome12 d)chromosome17
Homework Answers
The answer will be chromosome 17 (Option d).
Explanation: BRCA1 is a human tumor suppressor gene that is located on the long (q) arm of chromosome 17 & is responsible for repairing DNA. Thus correct answer will be option d.
Add Answer to:
A mutation in a gene(brca1)that causes breast cancer has been
identified in
a)chromosome2 b)chromosome10 c)chromosome12 d)chromosome17
A new mutation has been discovered that causes cancer. You have identified the gene sequence where...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
BRCA1 and BRCA2 are tumor suppressor genes that have been associated with breast cancer development due...
BRCA1 and BRCA2 are tumor suppressor genes that have been associated with breast cancer development due to mutations of these genes being linked to a subset of breast cancers. If an individual carries one nonfunctional copy of the BRCA gene, will all of their cells be affected? Explain.
what causes breast cancer ? what causes breast cancer more in woman than man? what are...
what causes breast cancer ? what causes breast cancer more in woman than man? what are the main prevention for breast cancer in woman? identify one educational approach that has been developed to address breast cancer?
what causes breast cancer ? what causes breast cancer more in woman than man? what are...
what causes breast cancer ? what causes breast cancer more in woman than man? what are the main prevention for breast cancer in woman? identify one educational approach that has been developed to address breast cancer? Please explain in 400 words
Question 20 CHOOSE THE BEST ANSWER A 70-year female patient has the BRCA1 mutation. Approximately, what...
Question 20 CHOOSE THE BEST ANSWER A 70-year female patient has the BRCA1 mutation. Approximately, what is her increased risk of developing breast cancer relative to the general population? 55-65% Normal BRCA genes BRCA1 mutation BRCA2 mutation 39% 45% Kisk of cancer (%) 12% 11% 1.3% Ovarian cancer by age 70 Breast cancer by age 70 Her risk is increased by 10 times. Her risk is increased by 60 times. Her risk is increased by 2 times. Ucar remare patient...
25. Which nursing diagnosis has the greatest priority when caring for a client recelving immunosuppressive agents?...
25. Which nursing diagnosis has the greatest priority when caring for a client recelving immunosuppressive agents? A. O Pain. B. OFatigue. C. Diarrhea. D. O Risk for infection. 3. Another woman in the class said she had heard that there isa genetic test that would diagnose breast cancer. What is the best response by the nurse? A O'A positive test for the BRCA1 mutation identifies an increased risk for breast cancer, but is not a certainty." B. "If the BRCA1...
In the general population, one woman in eight will develop breast cancer. Research has shown that...
In the general population, one woman in eight will develop breast cancer. Research has shown that 1 woman in 600 carries a mutation of the BRCA gene. Seven out of 10 women with this mutation develop breast cancer. Find the probability that a randomly selected woman will develop breast cancer given that she has a mutation of the BRCA gene. (Round to one decimal place as needed.)
3. Another woman in the class said she had heard that there is a genetic test...
3. Another woman in the class said she had heard that there is a genetic test that would diagnose breast cancer. What is the best response by the nurse? A. "A positive test for the BRCA1 mutation identifies an increased risk for breast cancer, but is not a certainty." B. "If the BRCA1 mutation test is positive it indicates an increased risk for emphysema." C. If the BRCA1 mutation test is positive, a bilateral mastectomy is the required." D. "A...
the scientist who initially identified the BRCA1 gene was (1)__________________ a. James Watson b. Charles Darwin...
the scientist who initially identified the BRCA1 gene was (1)__________________ a. James Watson b. Charles Darwin c. Mary Claire-King d.the X chromosome e.Chromosome17
Recent news articles have discussed the connection between a rare genetic mutation and breast cancer in...
Recent news articles have discussed the connection between a rare genetic mutation and breast cancer in women. One of the companies offering this BRCA genetic test is Quest, and this company claims a 97.5% accuracy rate. In the general population about 1 in 390 people would actually carry this BRCA1 genetic mutation. Hint: Construct a table as in your course materials. Use a population size of 39000 women. What is the likelihood that someone does not have the BRCA mutations,...
A new mutation has been discovered that causes cancer. You have identified the gene sequence where the mutation occurs. Below is the sequence from your mother who is normal and you who have this mutation in your DNA. Mother: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUCAACCUAUCCCUAAGGGUAAAAA 3' You: 5'AAGCUGAGGAGGAAUUAUGAUGGCCUGAACCUAUCCCUAAGGGUAAAAA 3' What type of mutation is shown in your DNA sequence? 01) Nonsense 2) Deletion 3) Missense 4) Frame shift
Question 20 CHOOSE THE BEST ANSWER A 70-year female patient has the BRCA1 mutation. Approximately, what is her increased risk of developing breast cancer relative to the general population? 55-65% Normal BRCA genes BRCA1 mutation BRCA2 mutation 39% 45% Kisk of cancer (%) 12% 11% 1.3% Ovarian cancer by age 70 Breast cancer by age 70 Her risk is increased by 10 times. Her risk is increased by 60 times. Her risk is increased by 2 times. Ucar remare patient...
25. Which nursing diagnosis has the greatest priority when caring for a client recelving immunosuppressive agents? A. O Pain. B. OFatigue. C. Diarrhea. D. O Risk for infection. 3. Another woman in the class said she had heard that there isa genetic test that would diagnose breast cancer. What is the best response by the nurse? A O'A positive test for the BRCA1 mutation identifies an increased risk for breast cancer, but is not a certainty." B. "If the BRCA1...
3. Another woman in the class said she had heard that there is a genetic test that would diagnose breast cancer. What is the best response by the nurse? A. "A positive test for the BRCA1 mutation identifies an increased risk for breast cancer, but is not a certainty." B. "If the BRCA1 mutation test is positive it indicates an increased risk for emphysema." C. If the BRCA1 mutation test is positive, a bilateral mastectomy is the required." D. "A...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago