Question

a) Draw a diagram of a generic (euk) gene at the DNA level, label all significant...

a) Draw a diagram of a generic (euk) gene at the DNA level, label all significant regions and briefly describe their role and the cellular process in which they function/are used. Do the same with a pre-RNA and mature
RNA.
b) Describe the difference between the coding and template strands of DNA
c) Describe, in general what the ribosome is: molecular composition and structure, cellular location(s), specific function. Compare/contrast prok and eukaryotic ribosomes

0 0
Add a comment Improve this question Transcribed image text
Answer #1

b) template strand is the 3'--->5' DNA strand. mRNA is synthesized by transcription using the 3'--->5' DNA strand. So only it is called the template strand. The initially synthesized mRNA will have the same sequence to that of the 5'---->3' DNA strand. So this 5'--->3' DNA strand is called coding strand.
c) Ribosome is a protein synthesizing complex molecule, which is made up of ribosomal RNA and some proteins.
There are two types of Ribosomes. They are 70S and 80S Ribosomes.
70S Ribosomes are present in prokaryotic cells and in plastids and mitochondria. 80S Ribosomes are present in the cytoplasm and on the rough endoplasmic reticulum of the eukaryotic cells.  
70 S Ribosomes are made up of one large and one small subunit. They are 50 S and 30 S.
80 S Ribosomes are made up of one large and one small subunit. They are 60 S and 40 S.
The rRNA molecules that are used for the construction of 70 S and 80 S are different.

Add a comment
Know the answer?
Add Answer to:
a) Draw a diagram of a generic (euk) gene at the DNA level, label all significant...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism.

    This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right    Right to Left Lagging to Leading    A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...

  • DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication

    Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...

  • What is a gene? Describe the function, structure, and location within the cell. What are the...

    What is a gene? Describe the function, structure, and location within the cell. What are the three stop codons? What is the start codon? Compare and contrast bacterial and eukaryotic ribosomes. Do a web search to find another example of a disease caused by a mutation in a single gene. Do the resulting symptoms (new trait) make sense considering the role of the affected protein? Why or why not? Transformation, conjugation, and transduction were discovered in the laboratory. How important...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • 1. The virus hijacks the cell, and RNA polymerases produce the complement to the positive stranded...

    1. The virus hijacks the cell, and RNA polymerases produce the complement to the positive stranded RNA genome. We can call these strands negative strands, and they then serve as templates for RNA polymerases to produce their complement. How does the sequence of these strands, the complement to the negative strands, compare with the original viral genome? 2-1. RNA polymerases lack proofreading ability. Define proofreading ability and describe its importance in replication of DNA genomes. a. Why is this a...

  • How are organisms biologically organized? Describe the anatomy of the eukaryotic cell (animal and plant). Major...

    How are organisms biologically organized? Describe the anatomy of the eukaryotic cell (animal and plant). Major difference between eukaryotes and prokaryotes. Describe the different types of chemical bonds. How do they affect the organization of biomacromolecules? Differentiate between a peptide bond, a phosphodiester, a phosphoanhydride bond. What are disulfide bridges? Amino-acids participating in this bonding? Describe the function of enzymes. Understand the forces by which substrates bind to enzymes. Distinguish between redox reactions and activated energy carriers. Distinguish between anabolism...

  • Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in...

    Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in lab) Prerequisite: Basic catabolic pathways (respiration and fermentation) and anabolic reactions (photosynthesis) BACTERIAL GROWTH AND CONTROL- Some of these topics will be covered in greater detail during lab Environmental Growth Factors 1. Discuss the specific role of quorum sensing in biofilm formation Control of Microbial Growth 2. Describe the methods used to control microbial growth 3. List the types of antibiotics that inhibit (a)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT