a) Draw a diagram of a generic (euk) gene at the DNA
level, label all significant regions and briefly describe their
role and the cellular process in which they function/are used. Do
the same with a pre-RNA and mature
RNA.
b) Describe the difference between the coding and template strands
of DNA
c) Describe, in general what the ribosome is: molecular composition
and structure, cellular location(s), specific function.
Compare/contrast prok and eukaryotic ribosomes
b) template strand is the
3'--->5' DNA strand. mRNA is synthesized by transcription using
the 3'--->5' DNA strand. So only it is called the template
strand. The initially synthesized mRNA will have the same sequence
to that of the 5'---->3' DNA strand. So this 5'--->3' DNA
strand is called coding strand.
c) Ribosome is a protein synthesizing complex molecule, which is
made up of ribosomal RNA and some proteins.
There are two types of Ribosomes. They are 70S and 80S
Ribosomes.
70S Ribosomes are present in prokaryotic cells and in plastids and
mitochondria. 80S Ribosomes are present in the cytoplasm and on the
rough endoplasmic reticulum of the eukaryotic
cells.
70 S Ribosomes are made up of one large and one small subunit. They
are 50 S and 30 S.
80 S Ribosomes are made up of one large and one small subunit. They
are 60 S and 40 S.
The rRNA molecules that are used for the construction of 70 S and
80 S are different.
a) Draw a diagram of a generic (euk) gene at the DNA level, label all significant...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
What is a gene? Describe the function, structure, and location within the cell. What are the three stop codons? What is the start codon? Compare and contrast bacterial and eukaryotic ribosomes. Do a web search to find another example of a disease caused by a mutation in a single gene. Do the resulting symptoms (new trait) make sense considering the role of the affected protein? Why or why not? Transformation, conjugation, and transduction were discovered in the laboratory. How important...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
1. The virus hijacks the cell, and RNA polymerases produce the complement to the positive stranded RNA genome. We can call these strands negative strands, and they then serve as templates for RNA polymerases to produce their complement. How does the sequence of these strands, the complement to the negative strands, compare with the original viral genome? 2-1. RNA polymerases lack proofreading ability. Define proofreading ability and describe its importance in replication of DNA genomes. a. Why is this a...
How are organisms biologically organized? Describe the anatomy of the eukaryotic cell (animal and plant). Major difference between eukaryotes and prokaryotes. Describe the different types of chemical bonds. How do they affect the organization of biomacromolecules? Differentiate between a peptide bond, a phosphodiester, a phosphoanhydride bond. What are disulfide bridges? Amino-acids participating in this bonding? Describe the function of enzymes. Understand the forces by which substrates bind to enzymes. Distinguish between redox reactions and activated energy carriers. Distinguish between anabolism...
Chapters 7, 8, 9 - Bacterial Growth & Metabolism (some chapter sections will be covered in lab) Prerequisite: Basic catabolic pathways (respiration and fermentation) and anabolic reactions (photosynthesis) BACTERIAL GROWTH AND CONTROL- Some of these topics will be covered in greater detail during lab Environmental Growth Factors 1. Discuss the specific role of quorum sensing in biofilm formation Control of Microbial Growth 2. Describe the methods used to control microbial growth 3. List the types of antibiotics that inhibit (a)...