Explain: a. What are the functions of helices and SSB proteins? b. What DNA sequence elements...
Explain:
a. What are the functions of helices and SSB proteins?
b. What DNA sequence elements define a transcription unit and how do they relate to the RNA that is produced?
c. What are the possible modes of activity of a transcription factor?
Homework Answers
Add Answer to:
Explain:
a. What are the functions of helices and SSB proteins?
b. What DNA sequence elements...
What are SOS gene products? How are they induced? A. SOS proteins (RecA, SSB, uvrABC, etc);...
What are SOS gene products? How are they induced? A. SOS proteins (RecA, SSB, uvrABC, etc); nicked DNA binds to the Lac repressor, causing its release and degradation, thereby triggering expression of the SOS genes B. SOS proteins are the heat-shock proteins; the “chi” sequence binds to some transcription factors inducing expression of these genes C. SOS proteins are only transcription factors that activate other genes; DNA damage causes induction of these transcription factors through single-stranded DNA binding proteins D....
1. this proteins is responsible for increasing or decreasing supercoiling of DNA A. Helicase B. DNA...
1. this proteins is responsible for increasing or decreasing supercoiling of DNA A. Helicase B. DNA Polymerase C. Topoisomerase D. RNA Polymerase E. DNA ligase 2. a gene is best defined as A. A segment of DNA that contains inherited information that defines the structure of a protein or RNA B. thee nucleotides that code for an amino acid C. a translated unit of DNA D. a sequence of nucleotides in RNA that codes for a functional product 3. This...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
What is ONE technique to determine the SEQUENCE of DNA/RNA AND proteins?
What is ONE technique to determine the SEQUENCE of DNA/RNA AND proteins?
can someone help explain part b 4. Transcription. The DNA below contains a promoter sequence recognized...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B....
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B. RNA Pol 2 C.RNA Pol 3 D.RNA Pol 4 E. Not sure A promoter is.... A. Proteins that defines the beginning of a gene B. DNA elements that help define the beginning of a gene C. It is the DNA sequence at the start of a gene D. Not sure Promoters TATA Start site What is the TATA box? A. It's a DNA sequence...
1. Viruses are a. cells containing DNA and protein. b. larger than most bacteria. c. acellular....
1. Viruses are a. cells containing DNA and protein. b. larger than most bacteria. c. acellular. d. able to take in nutrients and expel wastes. e. mutated forms of DNA. 2. Beginning with a single bacterium, how many cells would be present after 4 hours of growth if they can double every 20 minutes? a. 12 b. 24 c. 64 d. 4,096 e. 34,217,728 3. The genetic information of viruses can be a. DNA. b. RNA. c. single-stranded. d. double-stranded....
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...
8. How is DNA packaged in eukaryotes? Describe the different fibers and the proteins they use....
8. How is DNA packaged in eukaryotes? Describe the different fibers and the proteins they use. 9. Define the following: a. Helicase b. Ligase C. DNA polymerase d. Topoisomerase e. Single stranded binding proteins f. RNA primer g. Primase h. Nucleotide triphosphate I. Replication bubble - eukaryote vs prokaryote j. Nuclease k. Chromatin I. Chromosome m. Gene n. Genome o. Promoter 10. What is the function of mRNA 11. What is the mRNA strand that would be copied from this...
Part A: How do proteins differentiate between ssRNA, dsRNA, DNA-RNA hybrids, and dsDNA? Part B: Why...
Part A: How do proteins differentiate between ssRNA, dsRNA, DNA-RNA hybrids, and dsDNA? Part B: Why are the alpha helix and the beta sheet the most common secondary structure elements? Part C: Describe the two ways proteins can interact with DNA, and the differences between both. Which is similar to the RNA recognition motif?
please explain a and b
shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
can someone help explain part b
4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (KNAP): 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTT-5'. A) B) Draw boxes around the two promoter elements, centered at -10 and -35. relative to the start site of transcription Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as the template for RNA synthesis....
Which of these is involved in the transcription of tRNA genes? A. RNA Pol 1 B. RNA Pol 2 C.RNA Pol 3 D.RNA Pol 4 E. Not sure A promoter is.... A. Proteins that defines the beginning of a gene B. DNA elements that help define the beginning of a gene C. It is the DNA sequence at the start of a gene D. Not sure Promoters TATA Start site What is the TATA box? A. It's a DNA sequence...
1. DNA is coiled around what type of proteins to form nucleosomes A. Polymerases DNA replication of the lagging strand is discontinuous B. Transcription factors DNA replication of the lagging strand is continuous C. Helicases D. Histones E. DICER 2. Which of the following statements is true? A. DNA replication of the leading strand is discontinuous B. DNA replication of the lagging strand is discontinuous C. DNA replication of the leading strand is dispersive D. DNA replication of the lagging...
8. How is DNA packaged in eukaryotes? Describe the different fibers and the proteins they use. 9. Define the following: a. Helicase b. Ligase C. DNA polymerase d. Topoisomerase e. Single stranded binding proteins f. RNA primer g. Primase h. Nucleotide triphosphate I. Replication bubble - eukaryote vs prokaryote j. Nuclease k. Chromatin I. Chromosome m. Gene n. Genome o. Promoter 10. What is the function of mRNA 11. What is the mRNA strand that would be copied from this...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago