Describe how chromatin structure can be inherited and how this might be important biologically.
Histone Modification-Based Chromatin Inheritance
Current models of chromatin inheritance are based on experimental evidence on the fate of nucleosomal histones following DNA replication. Studies using pulse-chase experiments followed by fractionation to measure chromatin-bound histones strongly suggest that at the bulk level parental histones H3 and H4 do not exchange with newly synthesized H3 and H4 but remain bound to the newly replicated daughter DNA strands (Jackson and Chalkley, 1974) . These studies and electron microscope images of replicating chromatin further suggest that during DNA replication parental histones are distributed randomly between the two daughter DNA strands (Jackson and Chalkley, 1985; Sogo et al., 1986). More recently, genome-wide studies in budding yeast using an epitope tag exchange strategy that allows parental histones to be distinguished from newly synthesized ones have defined the patterns of parental histone inheritance, demonstrating histone retention at a gene-specific level (Radman-Livaja et al., 2011). Together with extensive evidence on the role of histone posttranslational modifications in the regulation of transcription, these studies have given rise to the proposal that histone modifications can be re-established by complexes that recognize a specific modification on an inherited parental histone and catalyze the same type of modification on adjacent newly deposited nucleosomes (Dodd et al., 2007; Grewal and Moazed, 2003; Kaufman and Rando, 2010; Kouzarides, 2007; Rusche et al., 2003; Strahl and Allis, 2000; Suganuma and Workman, 2008) (Figure 1). With some important differences (discussed later), this model is similar to how the maintenance DNA methyltransferase, Dnmt1, is thought to re-establish DNA methylation patterns by preferentially associating with and methylating hemimethylated DNA (Holliday, 1987; Schaefer et al., 2007). The model requires that histone modifications provide sufficient specificity to directly or indirectly recruit cognate-modifying enzymes and that the kinetics of their erasure is slower than the kinetics of postreplication re-establishment. Although in principle this mechanism based entirely on histones could account for the epigenetic inheritance of chromatin states, experiments in yeast and flies, discussed below, suggest that histone modifications alone are not sufficient for epigenetic inheritance.
Storage of eukaryotic DNA in small, compact nuclei requires that this DNA be tightly coiled and compacted in the form of chromatin. However, the structure of chromatin also appears to serve a second, possibly more important role, in that it gives eukaryotic cells the capability to exert complex levels of control over gene expression.
As described throughout this article, chromatin and the DNA
sequences it contains are constantly undergoing modifications,
thereby periodically exposing different regions of DNA to
transcription factors and RNA polymerases. The cumulative effects
of these changes are various states of transcriptional control and
the ability of eukaryotic cells to turn genes on and off as needed.
This complexity provides eukaryotes with a means of making the most
of a relatively small number of genes. However, much research
remains to be performed before investigators precisely understand
how the many mechanisms of chromatin remodeling operate, as well as
how they work together to result in the complex patterns of gene
expression
characteristic of eukaryotic
cells.
Describe how chromatin structure can be inherited and how this might be important biologically.
The following sentences describe chromatin structure and how altering chromatin structure can affect gene expression. Complete each sentence using the words provided.In some cells, DNA combines with proteins to form a substance calledThe lowest level of chromatin structure consists of DNA wrapped twice around a group of histones to form a(n)The formation of nucleosomes may block the binding of transcription factors and RNA polymerase II to theThe structure of chromatin can be modified by altering either the DNA or the...
describe how chromatin can be used to limit the transcription of genes. include the differences between euchromatin, and heterochromatin, and how the two types of chromatin can be interchanged.
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
1. briefly describe the structure of chromatin. 2.Explain how DNA gyrase works 3. sketch a typical Cloverleaf structure for transfer RNA. Point out any similarities between the cloverleaf pattern and the proposed structures of ribosomal RNA. 4. which type of RNA has the least amount of secondary structure?
What enzymes modify chromatin? How might a transcriptional activator recruit factors that modify chromatin? transcriptional repressor?
18. Describe one reason why the cell might want chromatin to be more tightly packaged during M phase compared to the other phases of the cell cycle?
Proteins are long chained polypeptides that are biologically active. Describe what comprises proteins and how proteins may be formed. What are the different classes of proteins? What are the various layers of structure to a protein? Describe what each layer entails or describes. What are the various ways to disrupt a protein? Are there mechanisms which will “kill” a protein that are not outlined in the text?
Please describe a genetically inherited phenotypic characteristic that can be considered an adaptation in Giraffes. Also, please explain how it might have evolved by the following: Its selective advantage, agents of selection, and fitness consequences. Please explain this in 3 or more paragraphs.
Please describe a genetically inherited phenotypic characteristic that can be considered an adaptation in Giraffes. Also, please explain how it might have evolved by the following: Its selective advantage, agents of selection, and fitness consequences. Please explain this in 3 or more paragraphs.
How are organisms biologically organized? Describe the anatomy of the eukaryotic cell (animal and plant). Major difference between eukaryotes and prokaryotes. Describe the different types of chemical bonds. How do they affect the organization of biomacromolecules? Differentiate between a peptide bond, a phosphodiester, a phosphoanhydride bond. What are disulfide bridges? Amino-acids participating in this bonding? Describe the function of enzymes. Understand the forces by which substrates bind to enzymes. Distinguish between redox reactions and activated energy carriers. Distinguish between anabolism...