Restriction enzymes that leave ends that are the same length on both sides of the double...
Restriction enzymes that leave ends that are the same length on both sides of the double helix, such as an enzyme that cuts the recognition site GGCC between the G and C, are called ________ restriction enzymes.
Homework Answers
These are called blunt ended enzyme because remaining sequence become non- cohesive
Add Answer to:
Restriction enzymes that leave ends that are the same length on
both sides of the double...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
Which of the following restriction enzymes do(es) generate sticky ends? A) Enzyme Recognition &n
Which of the following restriction enzymes do(es) generate sticky ends? A) Enzyme Recognition BamHI G↓GATCC CCTAG↑G B) Enzyme Recognition EcoRI G↓AATTC CTTAA↑G C) Enzyme Recognition HaeIII GG↓CC CC↑GG D) Enzyme Recognition HindIII A↓AGCTT TTCGA↑A E) all of the above, except c
Which combinations of enzymes in the table leave compatible ends (ends that can be ligated together)?...
Which combinations of enzymes in the table leave compatible ends (ends that can be ligated together)? The symbol indicates the cleavage site. Check all that apply. Re tion Enzyme Recognition Site AT TAAT sp 1208l AT CGAT CGGCCG GG CGCC CA TATG ag Ner l Nori TAAT TAA PstI PvuI eo CTGCA G Check Al Thet Apply Cla l, Narl, and Taql Ase I and Nde l Eag I and Notl 。Pac l and Pvul Bsp 12861 and Pst I
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs...
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, dige...
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme...
A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme 1 cuts the plasmid in one place while restriction enzyme 2 cuts in two places. All restriction sites are at least 1kB apart from each other. Based on this information, the resulting gel should have _____ bands for the enzyme 1 reaction, _____ bands for the enzyme 2 reaction, and _____ bands for the reaction that contains both enzymes A 1; 2; 3 B...
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends...
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends are DNA fragments that carry a higher charge than normal after they have been cleaved are DNA fragments cleaved by a restriction enzyme so that one strand is longer than the other C. Sticky ends are DNA fragments cleaved by a restriction enzyme so that both strands are the same length. D. Sticky ends are DNA fragments that attract a carbohydrate molecule to one...
. Isoschizomers are restriction enzymes that recognize the same sequence, but may not cut in the...
. Isoschizomers are restriction enzymes that recognize the same sequence, but may not cut in the same position. You want to cut at the site G/GCGCC, but do not have SspDI. What isoschizomer could you use to cut in the same position? (Hint: Use the Enzyme Finder tool at New England Biolabs website) (1 point)
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
Part B. Please CHOOSE FOUR of the following FIVE questions, indicating clearly which you want to...
Part B. Please CHOOSE FOUR of the following FIVE questions, indicating clearly which you want to be graded. Do not answer all of them!! (15 points each.) B1. Please consider the restriction enzymes Apal and PspOMI (OMG, who THINKS of these names???). Anyway, these enzymes have the following recognition/cut sequences, with the * indicating the cut site: Apali 5'G GGCC*C 3 3'C *C C G G G 51 PspOMI: 5' G *GG CCC 31 3' C C C G G#...
Which combinations of enzymes in the table leave compatible ends (ends that can be ligated together)? The symbol indicates the cleavage site. Check all that apply. Re tion Enzyme Recognition Site AT TAAT sp 1208l AT CGAT CGGCCG GG CGCC CA TATG ag Ner l Nori TAAT TAA PstI PvuI eo CTGCA G Check Al Thet Apply Cla l, Narl, and Taql Ase I and Nde l Eag I and Notl 。Pac l and Pvul Bsp 12861 and Pst I
The PCR was a success and your target region of 440 bp in length has been amplified. You ligate a short linker containing an Apal restriction enzyme site onto both ends of the PCR product, digest it with Apal, and clone it into the Apal site of the 5 kb plasmid diagrammed below amHI 300 EcoRI 5 kb 3400 1000 EcoRI 2000 Apal Draw the plasmid containing the cloned insert. Indicate clearly where the insert will be located. Include RE...
15- Which option BEST describes sticky ends by restriction enzymes B. Sticky ends A. Sticky ends are DNA fragments that carry a higher charge than normal after they have been cleaved are DNA fragments cleaved by a restriction enzyme so that one strand is longer than the other C. Sticky ends are DNA fragments cleaved by a restriction enzyme so that both strands are the same length. D. Sticky ends are DNA fragments that attract a carbohydrate molecule to one...
Part B. Please CHOOSE FOUR of the following FIVE questions, indicating clearly which you want to be graded. Do not answer all of them!! (15 points each.) B1. Please consider the restriction enzymes Apal and PspOMI (OMG, who THINKS of these names???). Anyway, these enzymes have the following recognition/cut sequences, with the * indicating the cut site: Apali 5'G GGCC*C 3 3'C *C C G G G 51 PspOMI: 5' G *GG CCC 31 3' C C C G G#...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago