For displaying nucleotide sequences, I like to use the font ‘Courier New’. What feature of this...
For displaying nucleotide sequences, I like to use the font ‘Courier New’. What feature of this font makes it more useful for nucleotide sequences than other common fonts, like Times New Roman or Calibri? (give 1 point)
Homework Answers
Answer:
Courier New has a monospaced font, also called a fixed-pitch, fixed-width, or non-proportional font.
It is preferred to use a monospaced font as these fonts assure that the representation of each nucleotide/amino acid sequence would occupy the same amount of space. This helps in sequence comparison as both sequences would be spaced equally despite having different letters to represent their respective sequences.
Add Answer to:
For displaying nucleotide sequences, I like to use the font
‘Courier New’. What feature of this...
: Times New Roman - 12 BIU.ab x, * AO AOA - Aa- A Font Styles...
: Times New Roman - 12 BIU.ab x, * AO AOA - Aa- A Font Styles Editing Dictate Ă - 21 aragraph ad i P Styles Voice Question 2 (1 point) Saved Myer 1. ~ 2.H₂O ora i or or on oma IV What is the product for the above reaction? 0 1) O2) 0 3) 4) v 0 of 7 O words DE O te O Type here to search
Create a pamphlet (text only, no longer than 250 words, 12-point Times New Roman font, double...
Create a pamphlet (text only, no longer than 250 words, 12-point Times New Roman font, double spaced) detailing the process of pregnancy and childbirth for expectant fathers. For example, what changes can the father expect in his partner? What changes do the embryo and fetus undergo during each trimester? Why is nutrition so important during pregnancy? What will the newborn look like? How stress influences the embryo and fetus? How can he support the mother during pregnancy and childbirth? Why...
An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences...
An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences should be contained in your discussion in of the product, marketing plan, and business proposition. Every important sales presentation should contain most - if not all of the presentation mix ingredients. There is a chart in this chapter that looks like a pie chart with a center - exhibit 11.5....
The assignment is to write 2+ pages (APA format - Times New Roman, 12 point font,...
The assignment is to write 2+ pages (APA format - Times New Roman, 12 point font, double spaced) and thoroughly explain your answer to the following: 1. Tell us about a time where you challenged your pre-existing worldview. Why? Would you do this again? In this essay, choose a time that you were able to listen to experiences and perspectives contrary to yours with respect and maturity. Demonstrate that you are able to zoom out from your personal worldview and...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
Humans and Chimps share a 9,826 nucleotides out of 10,000 in sequences. Therefore, the Human and...
Humans and Chimps share a 9,826 nucleotides out of 10,000 in
sequences. Therefore, the Human and Chimp nucleotide difference out
of 10,000 is 174. Gorillas and my new species differ by only 165
nucleotides. A) K=(-3/4)In(1-(4(0.0174)/3))=0.0176050171.
L=K/2t=0.0176050171/2(6600000)=1.33x10^-9. B)
K=(-3/4)In(1-(4(0.0165)/3))=0.0166842067. t=K/2L=0.0166842067. That
is 6.2x10^6 years ago. By using the molecular clock method to
estimate the two species, we can say that the species most likely
diverged nearly 6 million years ago. C) I am uncertain what to
write here but I...
I need help with these questions I answered my original answer is found below, the professor...
I need help with these questions I answered my original answer is found below, the professor marked it incorrect/ and or insufficient answer. 1)Why are phylogenetic trees based on molecular/ genetic data more reliable than trees based on morphology? - The morphological phylogenetic tree is quantitative data. This means physical characteristics; therefore, this is not the tree that would be a close representation of the true phylogenetic tree. Molecular phylogenetic trees, use DNA or RNA/ protein sequences. This makes Molecular...
In general I would like to know as to known or what is/are the standard references...
In general I would like to know as to known or what is/are the standard references about R-charge renormalization in supersymmetric theories. When does it do so and what is expected or known to be interesting. A little more specifically I want to know whether something is particularly special if the R-charge of the scalar chiral superfield in some theory is seen to be flowing to values greater than 1/2 under the flow. And if the R-charge of the scalar...
15G #1 13.2 Displaying Data and Interpreting Data Displays CA-317 Class Activity 15G Displaying Data About...
15G #1
13.2 Displaying Data and Interpreting Data Displays CA-317 Class Activity 15G Displaying Data About Pets CCSS CCSS SMP4, 3.MD.3 A class collected information about the pets they have at home, as shown in the table below. Pets at Home Name Michelle 1 dog, 2 cats Tyler Antrice |hamster Yoon-He 1 cat Anne Peter Brandon 1 guinea pig Brittany 1 dog. I cat Orlando none I salamander, 2 snakes, 3 dogs none 2 dogs Chelsey 2 dogs, 10 fish...
Cause and Effect Essay Assignment Requirements: • MLA Formatting (Times New Roman, 12 point font, double...
Cause and Effect Essay Assignment Requirements: • MLA Formatting (Times New Roman, 12 point font, double space, correct heading, correct header) • 3 pages(By 3 pages, I mean to the bottom of the third page, spilling over onto the forth, not two and some change.) • ANY outside sources/information must be cited IN THE ESSAY and on the Works Cited page Choose ONE of the following prompts: 1. Write an essay in which you analyze the effects from a horror...
: Times New Roman - 12 BIU.ab x, * AO AOA - Aa- A Font Styles Editing Dictate Ă - 21 aragraph ad i P Styles Voice Question 2 (1 point) Saved Myer 1. ~ 2.H₂O ora i or or on oma IV What is the product for the above reaction? 0 1) O2) 0 3) 4) v 0 of 7 O words DE O te O Type here to search
An important part of consultative selling is the use of questions to uncover the customer's needs. You have planned some of your questions in constructing your SELL Sequences. SELL Sequences should be contained in your discussion in of the product, marketing plan, and business proposition. Every important sales presentation should contain most - if not all of the presentation mix ingredients. There is a chart in this chapter that looks like a pie chart with a center - exhibit 11.5....
The assignment is to write 2+ pages (APA format - Times New Roman, 12 point font, double spaced) and thoroughly explain your answer to the following: 1. Tell us about a time where you challenged your pre-existing worldview. Why? Would you do this again? In this essay, choose a time that you were able to listen to experiences and perspectives contrary to yours with respect and maturity. Demonstrate that you are able to zoom out from your personal worldview and...
Humans and Chimps share a 9,826 nucleotides out of 10,000 in
sequences. Therefore, the Human and Chimp nucleotide difference out
of 10,000 is 174. Gorillas and my new species differ by only 165
nucleotides. A) K=(-3/4)In(1-(4(0.0174)/3))=0.0176050171.
L=K/2t=0.0176050171/2(6600000)=1.33x10^-9. B)
K=(-3/4)In(1-(4(0.0165)/3))=0.0166842067. t=K/2L=0.0166842067. That
is 6.2x10^6 years ago. By using the molecular clock method to
estimate the two species, we can say that the species most likely
diverged nearly 6 million years ago. C) I am uncertain what to
write here but I...
15G #1
13.2 Displaying Data and Interpreting Data Displays CA-317 Class Activity 15G Displaying Data About Pets CCSS CCSS SMP4, 3.MD.3 A class collected information about the pets they have at home, as shown in the table below. Pets at Home Name Michelle 1 dog, 2 cats Tyler Antrice |hamster Yoon-He 1 cat Anne Peter Brandon 1 guinea pig Brittany 1 dog. I cat Orlando none I salamander, 2 snakes, 3 dogs none 2 dogs Chelsey 2 dogs, 10 fish...
Cause and Effect Essay Assignment Requirements: • MLA Formatting (Times New Roman, 12 point font, double space, correct heading, correct header) • 3 pages(By 3 pages, I mean to the bottom of the third page, spilling over onto the forth, not two and some change.) • ANY outside sources/information must be cited IN THE ESSAY and on the Works Cited page Choose ONE of the following prompts: 1. Write an essay in which you analyze the effects from a horror...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago