When the structure of a DNA molecule is compared to a ladder, the uprights of the ladder are composed of
|
sugars. |
||
|
phosphates. |
||
|
purine-pyrimidine pairs. |
If a DNA molecule containing the base sequence 5 CAGTTA 3 unzipped during replication, and replication that occurred in the direction away from the replication fork (to right) and proceeded in three-base sequences, what would be the FIRST three-base sequence to be formed?
|
5 TTA 3 |
||
|
5 CAG 3 |
||
|
3 TTA 5 |
||
|
3 GTC 5 |
||
|
5 AAT 3 |
Introns occur only rarely in
|
animals. |
||
|
plants. |
||
|
fungi. |
||
|
bacteria. |
Halley is studying differences between human DNA and starfish DNA. Where might she find the greatest differences?
|
phosphates |
||
|
ribose |
||
|
deoxyribose |
||
|
bases |
||
|
amino acids |
The term ______________ explains a post-transcriptional gene regulation mechanism in eukaryotes in which multiple protein products are produced by a single gene.
|
mutation repair |
||
|
alternative splicing |
||
|
epigenetics |
||
|
gene expression |
DNA replicates by which of the following models?
|
conservative |
||
|
semiconservative |
||
|
dispersive |
||
|
none of the choices is correct |
If a DNA molecule contained the base sequence 5 TATCGTC 3 unzipped for replication, what would be the sequence of its complementary NEW strand?
|
5 ATAGCTG 3 |
||
|
5 ATAGCAG 3 |
||
|
3 ATAGCTG 3 |
||
|
5 ATAGTAG 3 |
||
|
3 ATAGCAG 5 |
When the structure of a DNA molecule is compared to a ladder, the uprights of the ladder are composed of
|
phosphates. |
||
|
purine-pyrimidine pairs. |
||
|
sugars. |
The term ___________ explains the process of removing introns and reconnecting exons in a pre-mRNA.
|
splicing |
||
|
DNA repair |
||
|
incision |
||
|
excision |
An unspliced RNA molecule is called
|
proto-RNA. |
||
|
mRNA. |
||
|
pre-mRNA. |
||
|
post transcript. |
Answer:
1). Purine-pyrimidine pairs
Explanation:
The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. The rungs of the ladder are pairs of 4 types of nitrogen bases. A=T & G=C pairs.
2). 3 GTC 5
Explanation:
Adenine (A) pairs with thymine (T) and vice versa.
Guanine (G) pairs with cytosine (C) and vice versa.
3’ = 5’ and vice versa.
3). Bacterial
Explanation:
Introns are well known in bacterial and archaeal genes, but occur more rarely than in most eukaryotic genomes.
4). Bases
Explanation:
Each DNA consists of deoxyribose, phosphate and nitrogen bases. Deoxyribose and phosphate are similar but number of bases is different in both the species.
5). alternative splicing
6). Semiconservative
Explanation:
Semiconservative replication would produce two copies that each contained one of the original strands and one new strand
7). 3 ATAGCAG 5
Explanation:
5 TATCGTC 3
3 ATAGCAG 5
8). Splicing
Explanation:
Introns are non-protein coding genes, so that they are removed before the mRNA enters into the translation, by a process called splicing.
9). pre-mRNA.
Explanation:
mRNA that was transcribe from DNA is called pre-mRNA, which contains introns and exons. Introns are removed by splicing and then the mRNA consists of one exons that is called mature mRNA.
When the structure of a DNA molecule is compared to a ladder, the uprights of the...
Are
these correct?
DNA - MULTIPLE CHOICE (2 pts) How many nurogenous bases are there in DNA? AT B) 2 C)3 ) - Which of the following is not a nitrogenous base found in DNA? A) Adenine B) Cytosine C) Guanine Uracil DNA is made up of Nitrogenous base pairs. The bases bond in which of the following patterns? A) Adenine - Thymine: Cytesine Guanine B) Adenine - Cytosinc; Guanine - Thymine C) Adenine - Guanine; Cytosine - Thymine D)...
Answer the questions:
Question 11 Recognition/binding site of RNA polymerase is called a Receptorb. Promoter . Facilitatord. Terminator Question 12 .A specific factor helps RNA polymerase binding to promoters and transcribe genes a Delta b. Beta Gamma d. Sigma Question 13 ............ Promoters lack a TATA box are referred to as TATA less promoters, for example operon Housekeeping genes b. Functional genesc d. Structural genes Question 14 0.5 points Save Answer During "RNA processing" All of the exons are a....
11. A gene is best defined as a. A segment of DNA b. Three nucleotides that code for an amino acid. C. A sequence of nucleotides in DNA that codes for a functional product. d. A sequence of nucleotides in RNA that codes for a functional product. e. A transcribed unit of DNA. 12. Which of the following statements is false? a. DNA polymerase joins nucleotides in one direction only. b. The leading strand of DNA is made continuously c....
Please answer 65 - 71!! Thank you!
65) base. Guanine is a base and uracil is a purine. purine b. purine, pyrimidine pyrimidine, purine pyrimidine, pyrimidine d. 66) a. Adenine is found in both RNA and DNA b. only RNA Only DNA 67) C. d The transmission of information from DNA to mRNA is called replication b. transcription translation 68) In the double helix the individual chains of polydeoxyribonucleotides are connected a. 5 to 3 and 3 to 5 b....
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
“Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...
5. About double strand DNA repair, it is correct to say that choose the most appropriate answer): (a) It requires one intact strand as a template for error correction. (b) Mismatches in the DNA are usually corrected via double strand DNA repair mechanisms. (c) Homologous recombination usually results in DNA repair with no loss of nucleotide at repair site. (d) Non-homologous end-joining usually results in DNA repair with no loss of nucleotide at repair site. 6. A eukaryote gene has two introns and three exons....
10. Which of the following statements best summarizes the differences between DNA and RNA? Group of answer choices DNA nucleotides contain a different pyrimidine base than RNA nucleotides. The bases in DNA contain sulfur, whereas the bases in RNA do not contain sulfur. The bases in DNA contain sugars, whereas the bases in RNA do not contain sugar. DNA encodes hereditary information, whereas RNA does not. DNA nucleotides contain a different purine base than RNA nucleotides. 9. A phospholipid is...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...