All eukaryotic mRNA has 3’ poly(A) tail. Can you design a strategy to isolate eukaryotic mRNA?
All eukaryotic mRNA has 3’ poly(A) tail. Can you design a strategy to isolate eukaryotic mRNA?
Homework Answers
Answer
All eukaryotic mRNA can be isolated by Poly-T affinity chromatography since it contains a poly-A tail. in which poly-A containing mRNA will bind to poly-T conjugated matrix and latter can be eluted as pure mRNA.
Add Answer to:
All eukaryotic mRNA has 3’ poly(A) tail. Can you design a
strategy to isolate eukaryotic mRNA?
What happens, in detail, to an mRNA in the cytoplasm if you remove the poly-A tail?
What happens, in detail, to an mRNA in the cytoplasm if you remove the poly-A tail?
Which of the following features of mRNA allows scientists to specifically isolate mRNA? o introns O...
Which of the following features of mRNA allows scientists to specifically isolate mRNA? o introns O 5' cap O 3' poly A tail O its sequence
There are several changes that occur to pre-mRNA in eukaryotic cells to produce the final mRNA...
There are several changes that occur to pre-mRNA in eukaryotic cells to produce the final mRNA molecule that will be used in translation. This process is called RNA processing. Which of the following occurs in the process of producing this final mRNA molecule? a poly-A tail is added to the 5' end a modified guanine nucleotide is added to the 3' end the introns are cut out and the exons are attached to each other none of the above
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
25. Which of the following is not true concerning eukaryotic mRNA processing (A) addition of a...
25. Which of the following is not true concerning eukaryotic mRNA processing (A) addition of a 3' poly-A tail (D) occurs in the nucleus (C) intron splicing (B) addition of a S' cap (E) occurs in the cytoplasm 26. Which of the following is involved in maintaining lysogeny in (A) PRE (B) PRM (C) PRI (D) PRO (E) all of the choices are correct Use the following diagram to answer questions 27-28. Each circle represents a DNA molecule and the...
can you make an outline/ give each step of transcription/ rna processing from: DNA to pre-mRNA...
can you make an outline/ give each step of transcription/ rna processing from: DNA to pre-mRNA processing initiation elongation termination transcription regulation transduction pathways, transcription factors, protein bridges termination/processing adding 3' poly A tail intron splicing alternative splicing lariat structure coupling transcription self splicing introns
Shown below is a eukaryotic pre-mRNA that has not undergone any processing. Exons are in blue...
Shown below is a eukaryotic pre-mRNA that has not undergone any processing. Exons are in blue and introns in red. 5 - CAUUGACCAUGGUCGGAAUGCCGACUGACCUCUAAGGCU - 3' Write (type) out what this pre-mRNA would look like when fully mature with all post-transcriptional modifications completed TT T Arial ✓ 3 (12pt) T Words:0 Path:p
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
Which of the following features of mRNA allows scientists to specifically isolate mRNA? o introns O 5' cap O 3' poly A tail O its sequence
There are several changes that occur to pre-mRNA in eukaryotic cells to produce the final mRNA molecule that will be used in translation. This process is called RNA processing. Which of the following occurs in the process of producing this final mRNA molecule? a poly-A tail is added to the 5' end a modified guanine nucleotide is added to the 3' end the introns are cut out and the exons are attached to each other none of the above
What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
25. Which of the following is not true concerning eukaryotic mRNA processing (A) addition of a 3' poly-A tail (D) occurs in the nucleus (C) intron splicing (B) addition of a S' cap (E) occurs in the cytoplasm 26. Which of the following is involved in maintaining lysogeny in (A) PRE (B) PRM (C) PRI (D) PRO (E) all of the choices are correct Use the following diagram to answer questions 27-28. Each circle represents a DNA molecule and the...
Shown below is a eukaryotic pre-mRNA that has not undergone any processing. Exons are in blue and introns in red. 5 - CAUUGACCAUGGUCGGAAUGCCGACUGACCUCUAAGGCU - 3' Write (type) out what this pre-mRNA would look like when fully mature with all post-transcriptional modifications completed TT T Arial ✓ 3 (12pt) T Words:0 Path:p
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago