HomeworkLib
Question

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify...

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode and sequence the DNA. After entering your sequence into BOLD the following comparison comes up.

Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAA

Species 2. ATGCAGCAAATTTGGGCATAGCCATGGTTGCAA

What DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.

a. deletion

b.inversion

c.duplication

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Duplication

Inversion

See image below -

Please rate high.

0 0
Add a comment
Know the answer?
Add Answer to:
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Please read the article and answer about questions. You and the Law Business and law are...

    Please read the article and answer about questions. You and the Law Business and law are inseparable. For B-Money, the two predictably merged when he was negotiat- ing a deal for his tracks. At other times, the merger is unpredictable, like when your business faces an unexpected auto accident, product recall, or government regulation change. In either type of situation, when business owners know the law, they can better protect themselves and sometimes even avoid the problems completely. This chapter...

  • This C++ Program consists of: operator overloading, as well as experience with managing dynamic memory allocation...

    This C++ Program consists of: operator overloading, as well as experience with managing dynamic memory allocation inside a class. Task One common limitation of programming languages is that the built-in types are limited to smaller finite ranges of storage. For instance, the built-in int type in C++ is 4 bytes in most systems today, allowing for about 4 billion different numbers. The regular int splits this range between positive and negative numbers, but even an unsigned int (assuming 4 bytes)...

  • How can we assess whether a project is a success or a failure? This case presents...

    How can we assess whether a project is a success or a failure? This case presents two phases of a large business transformation project involving the implementation of an ERP system with the aim of creating an integrated company. The case illustrates some of the challenges associated with integration. It also presents the obstacles facing companies that undertake projects involving large information technology projects. Bombardier and Its Environment Joseph-Armand Bombardier was 15 years old when he built his first snowmobile...

  • 10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated...

    10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated sludge operation that adversely affect effluent quality with origins in the engineering, hydraulic and microbiological components of the process. The real "heart" of the activated sludge system is the development and maintenance of a mixed microbial culture (activated sludge) that treats wastewater and which can be managed. One definition of a wastewater treatment plant operator is a "bug farmer", one who controls the aeration...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT