How would the primer be used in identification of Hepatitis C virus? This question regards identification...
How would the primer be used in identification of Hepatitis C virus?
This question regards identification of the Hepatitis C virus through a polymerase chain reaction.
Homework Answers
Polymerase chain reaction (PCR) is a method which is extensively used in molecular biology to make many copies of a specific DNA segment at a large scale within a vry short period of time.
HCV is a RNA virus. For this reson HCV RNA PCR test is used to determine whether the hepatitis C virus (HCV) exists in a person's bloodstream. If the virus is present, the test can also measure the exact amount (titer) in your blood. This amount is known as the viral load.
The primer used in the detection of specific pathogen should be very much accurate and specific, otherwise false positive result could be obtained. In HCV, primers are prepared from the 5' Non Coding region which have been reported to detect HCV virus precisely.
Add Answer to:
How would the primer be used in identification of Hepatitis C
virus?
This question regards identification...
A small number of genes in the unnamed virus appear similar to hepatitis C virus. When...
A small number of genes in the unnamed virus appear similar to hepatitis C virus. When doctors expose animals that had been injected with a hepatitis C vaccine to the unnamed virus, their blood shows a strong immune reaction to the unnamed virus (using a latex agglutination test). The blood of unvaccinated animals shows no reaction to the same test. What does this suggest about the shared genes?
please check my answers The Hepatitis C virus is found in the family Flaviviridae promotes persistent...
please check my answers
The Hepatitis C virus is found in the family Flaviviridae promotes persistent infection in the host which may lead to liver cancer is passed to others through blood and body fluids O is in the family Flaviviridae all of the above are correct If an animal virus has single stranded RNA as its genome, it will utilize the host cell RNA polymerase to replicate. True False
The current tests for SARS-CoV-2 virus rely on a type of PCR used specifically for RNA...
The current tests for SARS-CoV-2 virus rely on a type of PCR used specifically for RNA samples called “Reverse Transcriptase Polymerase Chain Reaction”. Explain the process of PCR and how it is used help determine if some has COVID-19.
Hepatitis C is a blood-borne infection with potentially serious consequences. Identification of social and environmental risk...
Hepatitis C is a blood-borne infection with potentially serious consequences. Identification of social and environmental risk factors is important because Hepatitis C can go undetected for years after infection. A study conducted in Texas in 1991-2 examined whether the incidence of hepatitis C was related to whether people had tattoos and where they obtained their tattoos. Data were obtained from existing medical records of patients who were being treated for conditions that were not blood-related disorders. The patients were classified...
The following primer sequence was used in a Sanger sequencing reaction along with the following template,...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
1.The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the...
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
Lab Activity: Discovering the Virus Responsible for Hepatitis C. Go to McGraw Hill Virtual Labs and...
Lab Activity: Discovering the Virus Responsible for Hepatitis C. Go to McGraw Hill Virtual Labs and select Part IX: Viruses and Simple Organisms. You are required to perform only lab 9-1 and 9-1B. -State the hypothesis and explain how you came up with it based on the initial observations. -You are asked to set up two sets of experiments to determine the specificity and sensitivity of the assay. -Briefly, explain the difference between these two experiments and the significance of...
multiple choice questions 32. All of the following are standard tests used for the diagnosis and prediction of respon...
multiple choice questions 32. All of the following are standard tests used for the diagnosis and prediction of response to treatment of hepatitis C except: (A) Hepatitis C antibody [EIA] (B) Patient IL-28B genotype testing (C) Hepatitis C antigen (D) Hepatitis C genotype (E) Hepatitis C RNA by polymerase chain reaction or transcription-mediated amplification 33. Which of the following is not associated with accelerated disease progression in hepatitis C? (A) alcohol use (B) coinfection with hepatitis B (C) coinfection with...
Describe human meiosis in detail. What is polymerase chain reaction and how was it used in...
Describe human meiosis in detail. What is polymerase chain reaction and how was it used in this article?
22-28 Consider the following nucleotide. Sodobno bilololle H ON on | 0-P-0-CH2 O N N CNH,...
22-28 Consider the following nucleotide. Sodobno bilololle H ON on | 0-P-0-CH2 O N N CNH, bring on Ch o osion obi D DO D olabo OH OH MODE a. What is the name of the nucleotide? b. Would this nucleotide be found in both DNA and RNA, only in DNA, or only in RNA? c. What is the name for the type of bond that connects the phosphate and sugar subunits? d. What is the name for the type...
please check my answers
The Hepatitis C virus is found in the family Flaviviridae promotes persistent infection in the host which may lead to liver cancer is passed to others through blood and body fluids O is in the family Flaviviridae all of the above are correct If an animal virus has single stranded RNA as its genome, it will utilize the host cell RNA polymerase to replicate. True False
1.The PCR (polymerase chain reaction) protocol that is currently
used in laboratories was facilitated by the discovery of a
bacterium called Thermus aquaticus in a hot spring inside
Yellowstone National Park, in Wyoming. This organism contains a
heat-stable form of DNA polymerase known as Taq
polymerase, which continues to function even after it has been
heated to 95°C.
a.Why would such a heat-stable polymerase be beneficial in
PCR?
b.What would happen if it weren’t
heat stable?
c.How might you choose...
22-28 Consider the following nucleotide. Sodobno bilololle H ON on | 0-P-0-CH2 O N N CNH, bring on Ch o osion obi D DO D olabo OH OH MODE a. What is the name of the nucleotide? b. Would this nucleotide be found in both DNA and RNA, only in DNA, or only in RNA? c. What is the name for the type of bond that connects the phosphate and sugar subunits? d. What is the name for the type...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago