Question

a. Which electrostatic interactions could occur between two arginine R-groups found in the core of a...

a. Which electrostatic interactions could occur between two arginine R-groups found in the core of a protein at pH = 7? Ionic, hydrogen bond, dipole-induced dipole, induced dipole-induced dipole? (more than one answer possible)

b. Which 3​° structural interaction between R-groups below could change or break, depending on the pH of the system? (more than one answer possible)
1. Asp-Asn
2. Pro-Phe
3. Ser-Thr
4. Glu-Arg
5. Ser-His

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
a. Which electrostatic interactions could occur between two arginine R-groups found in the core of a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • Based on the chemical properties of the residues, which of the following sequences could form the...

    Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category. Based on the chemical properties of the residues, which of the following sequences could form the following? At least one should be placed in each category Most likely an amphipathic Most likely an amphipathic B sheet a helix Most likely a turn/ loop Not amphipathic Asn-Leu-Ala-Asp-Ser-Phe-Arg-Gin-lle Lys-Ser-Thr-Asn-Glu-Gin-Asn-Ser-Arg Gin-lle-Thr-Phe-Thr-Leu-GIn-Val-Ser Lys-GIn-Asn-Glu-Pro-Arg-Ala-Asn-Glu Arg-Phe-GIn-lle-His-Val-Gin-Phe-Glu Ala-Phe-Leu-Val-lle-Trp-Phe-Val-Ala

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids:...

    Hydrophobic interactions may occur between the R-groups of which of the following pairs of amino acids: A. Arg and His B. His and Asp C. Tyr and Gly D. Phe and Trp E. Val and Asn

  • Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which...

    Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which will experience a change in their R-group interaction (eithera gain, loss or change specific type of interaction) when placed in a basic (pH 10) environment? (Select any/all that apply) Val, Ala GIn, Ser Asn, Cys Asp, Arg 1 nts Below are pairs of amino acids that interact with each other via their R groups to maintain protein structure. Which will...

  • 10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....

    10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...

  • The chemical structures of the 20 standard amino acids at pH 7, along with their 3...

    The chemical structures of the 20 standard amino acids at pH 7, along with their 3 and 1 letter codes, are givern in alphabetical order below. While the oxygen and nitrogen atoms of the peptide bonds may serve as a donor atom to complex a metal ion, very often the ligands for the metal come from the amino acid side chains. Takea few moments to examine the chemical structures of the different side chains. Circle the side chains that you...

  • 6. Calculate the born electrostatic free energy of transferring a monovalent cation (g = +1 and...

    6. Calculate the born electrostatic free energy of transferring a monovalent cation (g = +1 and r = 2.0 A) from water (Ewater = 80) to oil (oil = 2). AGsolv = _ _kcal/mol 7. Use regression analysis to derive an empirical equation for predicting amino acid transfer free energies (AGT) from the following data. Use the Wolfenden transfer data to develop your equation. Table 2. Three sets of transfer free energies for regression analysis Transfer free energy" (kcal mol-')...

  • C,D, and E i need help with. 17. The following peptide forms part of Human Hemoglobin...

    C,D, and E i need help with. 17. The following peptide forms part of Human Hemoglobin subunit gammaa Asp-Leu-Lys-Gly-Thr-Phe-Ala A) Which amino acids are likely to be on the side of peptid acids are likely to be on the side of peptide that faces the interior of the protein? Insert your answer leu, Gto.Pne, Ala B) Which are likely to be facing the aqueous environment? Insert your answer Asp, lys, Thr Draw the structure of the sequence at pH7.4. Using...

  • 5' or or Using the codon table provided, fill in the missing entries in the following...

    5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...

  • Which of the following is a weakly basic anion exchange resin? A. DEAE cellulose B. Dowex-50...

    Which of the following is a weakly basic anion exchange resin? A. DEAE cellulose B. Dowex-50 C. CM cellulose D. Sephadex E. Dowex-1 Which of the following amino acid sequences is most likely to be part of a Type II reverse turn? A. SVPWFF B. VYRHSL C. RALGFD D. GPPRPP E. AGPYSA Parallel beta-sheets are less stable than anti-parallel because? A. the H-bonds are not linear B. steric interactions between R groups lowers stability C. the H-bonds are linear D....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT