How would a DNA sequencing reaction be affected if the ratio of ddNTPs to dNTPs were...
How would a DNA sequencing reaction be affected if the ratio of ddNTPs to dNTPs were increased? What would the consequences be if the ratio were decreased? How is the resultant read and why?
Homework Answers
In a reaction, if the ratio of ddNTPs: dNTPs is increased the obtained sequence will be closer to the primer sequence. Since the primer sequence lack 3' OH, therefore, the next sequence is added from dNTPs instead of ddNTPs. If the concentration is higher the sequence obtained will be shorter and they will be more closely related to the ddNTPs. Similarly, if we decrease the ratio of ddNTP: dNTP the product will be longer and far away from the ddNTP sequence.
for example:
5' GATCAAACCCGTTATCTG
3'CTAGTTTGGGCAATAGACAAAGTCA5'
5'GATCAAACCCGTTATCTGTCCCGTAG
3'CTAGTTTGGGCAATAGACAGGGCATC5'
As we increase the concentration of the ddNTP the product is closely related to the primer sequence.
Add Answer to:
How would a DNA sequencing reaction be affected if the ratio of
ddNTPs to dNTPs were...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are
lacking a OH at the
a.
2' carbon
b.
5' carbon
c.
3' carbon
please answer as many as you can!! I am low on questions and
could use the help!
Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...
Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting...
Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting up a Sanger sequencing reaction, each reaction should include template DNA, nucleotides (dNTPs), dideoxynucleotides (ddNTPs), reaction buffer, DNA polymerase, and _____. (A) Forward and reverse primers (B) Forward or reverse primers (C) Forward and reverse probes (D) Forward or reverse probes
Dideoxy NTPs (ddNTPs) are used in sequencing reaction to terminate DNA polymerization reaction at various chain...
Dideoxy NTPs (ddNTPs) are used in sequencing reaction to terminate DNA polymerization reaction at various chain lengths. Which OH group on the carbohydrate (ribose) molecule is deoxidized in ddNTP, thus causes DNA polymerization to stop? O OH group on 1' carbon is deoxidized to-H O OH group on 2' carbon is deoxidized to-H O OH group on 3' carbon is deoxidized to -H O OH group on 4' carbon is deoxidized to-H O OH group on 5' carbon is deoxidized...
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling...
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make...
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make a library, and why you would use each one in respect to cost, size, % error, etc. Consider budget, what you want to get out of it, and is there merit to combine different technologies together?
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees...
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees or "trees of life". -Why would whole genome sequencing be better than sequencing parts of the bird genomes? -Besides humans, what group of animals would you recommend sequencing next and why? Justify your answer with some reasons.
If you wish to sequence a long strand of DNA in one round of reactions, you...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
What would the results of a Sanger sequencing read look like if you accidentally omitted the...
What would the results of a Sanger sequencing read look like if you accidentally omitted the deoxyCTP (dCTP) from the reaction? Multiple Choice No Cs could be incorporated into synthesis products, and so only peaks corresponding to the smallest synthesis products - none of which include a C - will appear. The results would be normal; dCTP is not required for Sanger sequencing - the only kind of C needed is ddCTP. All of the synthesis products would end with...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase that lacks 5'+3' exonuclease activity but has 3-5'exonuclease activity and polymerase activity. What will be the structure of the final product and what is the first step in the reaction sequence? 3' OH-TGCGAATTAGCGACAT-P5' 5'P-ATCGGTACGGCGCTTA-P 3' 12. You are screening a chemical for potential mutagenicity using the Ames test. You used a his-S. typhimurium bacterium for this test and obtained the following results: Chemical +...
If a hypothetical drug prevents actin from working properly, how would cell division be affected? DNA...
If a hypothetical drug prevents actin from working properly, how would cell division be affected? DNA synthesis would not occur cell elongation during anaphase would not occur spindle formation would not occur spindle attachment to kinetochores would not occur cleavage furrow formation and cytokinesis would not occur
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are
lacking a OH at the
a.
2' carbon
b.
5' carbon
c.
3' carbon
please answer as many as you can!! I am low on questions and
could use the help!
Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...
Dideoxy NTPs (ddNTPs) are used in sequencing reaction to terminate DNA polymerization reaction at various chain lengths. Which OH group on the carbohydrate (ribose) molecule is deoxidized in ddNTP, thus causes DNA polymerization to stop? O OH group on 1' carbon is deoxidized to-H O OH group on 2' carbon is deoxidized to-H O OH group on 3' carbon is deoxidized to -H O OH group on 4' carbon is deoxidized to-H O OH group on 5' carbon is deoxidized...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase that lacks 5'+3' exonuclease activity but has 3-5'exonuclease activity and polymerase activity. What will be the structure of the final product and what is the first step in the reaction sequence? 3' OH-TGCGAATTAGCGACAT-P5' 5'P-ATCGGTACGGCGCTTA-P 3' 12. You are screening a chemical for potential mutagenicity using the Ames test. You used a his-S. typhimurium bacterium for this test and obtained the following results: Chemical +...
If a hypothetical drug prevents actin from working properly, how would cell division be affected? DNA synthesis would not occur cell elongation during anaphase would not occur spindle formation would not occur spindle attachment to kinetochores would not occur cleavage furrow formation and cytokinesis would not occur
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago