How would a DNA sequencing reaction be affected if the ratio of ddNTPs to dNTPs were increased? What would the consequences be if the ratio were decreased? How is the resultant read and why?
In a reaction, if the ratio of ddNTPs: dNTPs is increased the obtained sequence will be closer to the primer sequence. Since the primer sequence lack 3' OH, therefore, the next sequence is added from dNTPs instead of ddNTPs. If the concentration is higher the sequence obtained will be shorter and they will be more closely related to the ddNTPs. Similarly, if we decrease the ratio of ddNTP: dNTP the product will be longer and far away from the ddNTP sequence.
for example:
5' GATCAAACCCGTTATCTG
3'CTAGTTTGGGCAATAGACAAAGTCA5'
5'GATCAAACCCGTTATCTGTCCCGTAG
3'CTAGTTTGGGCAATAGACAGGGCATC5'
As we increase the concentration of the ddNTP the product is closely related to the primer sequence.
How would a DNA sequencing reaction be affected if the ratio of ddNTPs to dNTPs were...
In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are
lacking a OH at the
a.
2' carbon
b.
5' carbon
c.
3' carbon
please answer as many as you can!! I am low on questions and
could use the help!
Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...
Even though you are sending your plasmid to Eton Bio for sequencing, if you were setting up a Sanger sequencing reaction, each reaction should include template DNA, nucleotides (dNTPs), dideoxynucleotides (ddNTPs), reaction buffer, DNA polymerase, and _____. (A) Forward and reverse primers (B) Forward or reverse primers (C) Forward and reverse probes (D) Forward or reverse probes
Dideoxy NTPs (ddNTPs) are used in sequencing reaction to terminate DNA polymerization reaction at various chain lengths. Which OH group on the carbohydrate (ribose) molecule is deoxidized in ddNTP, thus causes DNA polymerization to stop? O OH group on 1' carbon is deoxidized to-H O OH group on 2' carbon is deoxidized to-H O OH group on 3' carbon is deoxidized to -H O OH group on 4' carbon is deoxidized to-H O OH group on 5' carbon is deoxidized...
A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...
DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make a library, and why you would use each one in respect to cost, size, % error, etc. Consider budget, what you want to get out of it, and is there merit to combine different technologies together?
-Explain how DNA sequencing can be used to identify organisms and place them into phylogenetic trees or "trees of life". -Why would whole genome sequencing be better than sequencing parts of the bird genomes? -Besides humans, what group of animals would you recommend sequencing next and why? Justify your answer with some reasons.
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
What would the results of a Sanger sequencing read look like if you accidentally omitted the deoxyCTP (dCTP) from the reaction? Multiple Choice No Cs could be incorporated into synthesis products, and so only peaks corresponding to the smallest synthesis products - none of which include a C - will appear. The results would be normal; dCTP is not required for Sanger sequencing - the only kind of C needed is ddCTP. All of the synthesis products would end with...
11. The DNA molecule below is incubated with all four dNTPs, Mg+ and a DNA polymerase that lacks 5'+3' exonuclease activity but has 3-5'exonuclease activity and polymerase activity. What will be the structure of the final product and what is the first step in the reaction sequence? 3' OH-TGCGAATTAGCGACAT-P5' 5'P-ATCGGTACGGCGCTTA-P 3' 12. You are screening a chemical for potential mutagenicity using the Ames test. You used a his-S. typhimurium bacterium for this test and obtained the following results: Chemical +...
If a hypothetical drug prevents actin from working properly, how would cell division be affected? DNA synthesis would not occur cell elongation during anaphase would not occur spindle formation would not occur spindle attachment to kinetochores would not occur cleavage furrow formation and cytokinesis would not occur