how long is the m13 template ssdna in nucleotides

Question

Question

science chemistry

Answer 1

Answer #1

The length is 1000-2000 nucleotides length.

Answer 2

Similar Homework Help Questions

28. Before replication of the M13 genome, what step is required? 29. How does phage M13...

28. Before replication of the M13 genome, what step is required? 29. How does phage M13 exit the host cell?
A gene that is 6339 nucleotides long, how many amino acids are coded for

A gene that is 6339 nucleotides long, how many amino acids are coded for
5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ...

5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts) ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)

The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
The sequence for the lactate dehydrogenase gene of pigs is >1500 nucleotides long. A portion of...

The sequence for the lactate dehydrogenase gene of pigs is >1500 nucleotides long. A portion of the template strand sequence is listed as taccggagctgc. a. List the mRNA sequence and label 3' and 5' ends: b. List the coding strand sequence, labeling 3' and 5' ends: c. List the amino acid sequence specified:
If a gene is 500 nucleotides long, how many characters could be evaluated in total and...

If a gene is 500 nucleotides long, how many characters could be evaluated in total and what are the different possible character states?

6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...

6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.
M13 SPR (4) SPM Axle (2) T889SPM (8) The M13 Bill of Material is given here....

M13 SPR (4) SPM Axle (2) T889SPM (8) The M13 Bill of Material is given here. The table below shows your current inventory levels of each item. Item Quantity Axle SPM 396 SPR T889 8 How many additional units of SPM are needed to make 75 M13s?
How many nucleotides long would a DNA sequence need to be in order for it not...

How many nucleotides long would a DNA sequence need to be in order for it not to be found by chance more than once in a human genome (size is 3.2 x 10^9 base pairs)? Set up the correct calculation below - SHOW YOUR WORK!

An alignment of 2 homologus protein-coding nucleotide sequences 180 nucleotides long has approximately how many nonsynonomous...

An alignment of 2 homologus protein-coding nucleotide sequences 180 nucleotides long has approximately how many nonsynonomous sites? 20 60 90 120 An alignment of 2 homologus protein-coding nucleotide sequences 180 nucleotides long has approximately how many nonsynonomous sites? 20 60 90 120