The sequence for the lactate dehydrogenase gene of pigs is >1500 nucleotides long. A portion of the template strand sequence is listed as taccggagctgc.
a. List the mRNA sequence and label 3' and 5' ends:
b. List the coding strand sequence, labeling 3' and 5' ends:
c. List the amino acid sequence specified:
Given template DNA, 3' TAC CGG AGC TGC 5'
A. mRNA,
5' AUG GCC UCG ACG 3'
B.
5' ATG GCC TCG ACG 3'
C.
N met ala ser thr C
Please rate high.
The sequence for the lactate dehydrogenase gene of pigs is >1500 nucleotides long. A portion of...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
I have my own answers, i just want to check my work,
thanks!
Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.
The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...
5. The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA. 5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3' 3' GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC 5' a. Which strand is the template strand? [2 pts] b. Which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? [2 pts] c. What is the sequence of the nucleotides in the processed (mature)...