Question

1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% ,...

1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15%

a. Is this RNA molecules single stranded or double stranded? How Cant you tell?

b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA?

2.) Given the following DNA

5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3'

a. What is the transcript (mRNA) sequence?

b. What might be the amino acid sequence of the translated protein?

3.) In the sequence above suppose that the 18th nucloetide of the template was mutated to a T.

a. Now what is the mRNA sequence ?

b. What is the amino acid sequence of the translated protein?

c. Would this protein be able to carry out its function?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1- A - In the case of Double-stranded RNA Adenine is equal to the Uracil and Guanine is equal to the Cytosine.

Since A is not equal to U and G is not equal to C. So RNA is molecule is single-stranded.

B- If DNA has Adenine then RNA polymerase will add Uracil at its complementary base in the RNA. For Thymine, Adenine is added. For Guanine, CYtosine is added and for Cytosine, guanine is added.

So the template DNA strand has - T = 27% , A=38% , G=20% , C= 15%

2- A- mRNA sequence - AUGGCGAGGCGGCAGCUGUUAUGGUGA

Protein sequence - Met Ala Arg Arg Gln Leu Leu Trp

3- New DNA sequence - Given that in the template strand 18th nucleotide is mutated to T. It means in the coding strand new nucleotide will be A.

ATG GCG AGG CGG CAG CTA TTATGGTGA

mRNA sequence - AUGGCGAGGCGGCAGCUAUUAUGGUGA

Protein sequence - Met Ala Arg Arg Gln Leu Leu Trp

Since there is no change in the amino acid sequence, So protein will carry out its normal functions.

Please write to me if you need more help.

Add a comment
Know the answer?
Add Answer to:
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% ,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with...

    Mutation 3: ATG-TCA-GAT-CAG-CGG-ATC-CTA-TAG a. Replicate the DNA strand above (the original base has been replaced with the red one) b. Transcribe the replicated mutated strand to mRNA c. Translate the mRNA produced above to an amino acid sequence: d. What kind of mutation is this?

  • Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...

    Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...

  • 2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...

    2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....

    Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases. In the DNA molecule, guanine binds with ____________and adenine binds with ____________ in DNA; in RNA, adenine binds with _____________ instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be _______________. For the DNA codon GAT, the amino acid that would result would be__________________. The following questions relate to chs. 3 and...

  • Question 16: The following shows the same segment of DNA that was shown above in Question...

    Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...

  • 1. Explain the difference between spontaneous and induced mutations. Give an example of how each might...

    1. Explain the difference between spontaneous and induced mutations. Give an example of how each might be caused 2. For the double stranded DNA molecule shown below, the BOTTOM strand is the template for transcription. The START CODON is AUG and the STOP CODON IS UAA. a) Draw the mRNA transcript that would be made from this DNA molecule. b) Translate the mRNA and show the amino acid sequence of the encoded protein. 5’-AGGTCCAGTCTTCGGCGGATGATCGGGTCAAACCCGGGGTAACTGGTCACCGGCATCC-3’ 3’-TCCAGGTCAGAAGCCGCCTACTAGCCCAGTTTGGGCCCCATTGACCAGTGGCCGTAGG-5’

  • need help with part c Scie Clas Class DNA to Proteins (Gene Expression) You are given...

    need help with part c Scie Clas Class DNA to Proteins (Gene Expression) You are given the DNA template: 3' A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A-A- T-T-C-TS' Complete the following exercise: A. DNA replication. Write the sequence of complementary bases produced if the above DNA template undergoes replication. 3'A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A- A-T-T-C-T5' 3 T-T-A-T-C-A-T-G-C-G-C-T-C-A-G-C-A-C-t-A-C-T-T- T-A-A-G-AS' B. Transcription. Using the original DNA template, construct the sequence of nucleotide bases for the transcribed RNA strand. 3'AAT-AGT -ACG-CGA-GTC-GTG -ATG-AAA -TTC-T 3'UVA - UCA-UGC-GCU-CAG-CAC-AC - VUU-AAG-A5 C. Translation. Using the mRNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT