Outline an experiment to identify the splicing silencer and enhancer sequence and their location in the...
Outline an experiment to identify the splicing silencer and enhancer sequence and their location in the primary transcript.
Homework Answers
First mRNA gene contain all exons and introns ,promoters. removed all introns is called RNA splicing silencer The first transcription is happen only single RNA standarard to DNA called primary transcription the first enzyme is involved in RNA polymerase .this transcription products will be mRNA,rRNA, tRNA
And mainly mRNA will be starting precursor pre-mRNA synthesis to DNa it's called pre or primary transcription.
mRNA to Protein synthesis called Translation.
Add Answer to:
Outline an experiment to identify the splicing silencer and
enhancer sequence and their location in the...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
Below is shown an 8kb region of the human genome, with the proportion of the nucleotides that are identical between the human sequence and the homologous sequence from mouse on the top graph, and the...
Below is shown an 8kb region of the human genome, with the
proportion of the nucleotides that are identical between the human
sequence and the homologous sequence from mouse on the top graph,
and the location of sequences mapped from an RNA-sequencing
experiment on the bottom graph
What region is likely to be an
enhancer element upstream of the promoter?
What region is likely to be an enhancer element in an
intron?
100 % conservation RNA-seq 2000 4000 6000 8000...
outline the location of the following geographic location in south American the highest laterfall one of...
outline the location of the following geographic location in south American the highest laterfall one of the driest deserts in the world, the largest rainforest in the world Identify the countries where five different languages are spoken in south American. Discuss, Brazil by mentioning some main cities its size and attractions and name the only countries which it does not have a boarder with Brazil?
NISUUS UU NI pui CIOS VIVIENZync. 20. (4 pts) You are performing an experiment on eukaryotic...
NISUUS UU NI pui CIOS VIVIENZync. 20. (4 pts) You are performing an experiment on eukaryotic intron splicing and are trying to determine the mechanism by which a particular intron is spliced. You find that the primary transcript is spliced without presence of any protein. Based only on this information what can you conclude with confidence about this intron? (Check all that apply) It is an intron in mRNA. It is a Group I or Group Il intron. _It is...
For q51, group them. Help please. (Genetics) Please answer my questions. (Genetics) For Q 51) Just...
For q51, group them. Help please.
(Genetics)
Please answer my questions.
(Genetics)
For Q 51) Just put complementary groups together and
noncomplementary together.
RC 1 00 ,00 Question Completion Status: Given the figure below, identify the location of the following -25 +1 AAAAAAA 3 A-upstream enhancer TATA Box Transcription start site Enhancer Promoter Primary transcript Click Save and Submit to save and submit. Click Save All Answers to save all answers. Question Completion Status: QUESTION 51 A complementation test was...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...
Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
1. Define Alzheimer's disease and pre-Alzheimer's disease. 2. Identify the risk factors and prevalence of Alzheimer's disease. 3. Outline...
1. Define Alzheimer's disease and pre-Alzheimer's disease. 2. Identify the risk factors and prevalence of Alzheimer's disease. 3. Outline the course of Alzheimer's disease. 4. Compare and contrast the Global Deterioration Scale stages 1 to 7. 5. Discuss the main screening tools for Alzheimer's disease . 6. Identify Functional Assessment Staging stages 1 to 7. 7. Explain the psychopathology of Alzheimer's disease 8. Describe the potential physiological complications of Alzheimer's disease. 9. Relate the primary and differential diagnostic implications of Alzheimer's disease. 10.Define retro-genesis, and explain the evidence for...
What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the...
What control elements regulate expression of the mPGES-1 gene? The promoter of a gene includes the DNA immediately upstream of the transcription start site, but expression of the gene can also be affected by control elements. These can be thousands of base pairs upstream of the promoter, grouped in an enhancer. Because the distance and spacing of these control elements make them difficult to identify, scientists begin by deleting sections of DNA that contain possible control elements and measuring the...
EXPERIMENT 9: SYNTHESIS OF DIPHENYLACETYLENE Objective: Complete the two-step halogenation/elimination reaction sequence that converts an alkene...
EXPERIMENT 9: SYNTHESIS OF DIPHENYLACETYLENE Objective: Complete the two-step halogenation/elimination reaction sequence that converts an alkene (trans- stilbene) to an alkyne (diphenylacetylene) PRELAB NOTEBOOK: In the laboratory notebook, write the overall experimental objective, chemical equation(s), reaction mechanism. draw a diagram or outline of the procedural steps, and complete the chemical safety table for all chemicals. 1. Does this elimination process occur via an E1 or E2 mechanism? Justify your answer by explaining the specific factors that differentiate when E1 versus...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
Below is shown an 8kb region of the human genome, with the
proportion of the nucleotides that are identical between the human
sequence and the homologous sequence from mouse on the top graph,
and the location of sequences mapped from an RNA-sequencing
experiment on the bottom graph
What region is likely to be an
enhancer element upstream of the promoter?
What region is likely to be an enhancer element in an
intron?
100 % conservation RNA-seq 2000 4000 6000 8000...
NISUUS UU NI pui CIOS VIVIENZync. 20. (4 pts) You are performing an experiment on eukaryotic intron splicing and are trying to determine the mechanism by which a particular intron is spliced. You find that the primary transcript is spliced without presence of any protein. Based only on this information what can you conclude with confidence about this intron? (Check all that apply) It is an intron in mRNA. It is a Group I or Group Il intron. _It is...
For q51, group them. Help please.
(Genetics)
Please answer my questions.
(Genetics)
For Q 51) Just put complementary groups together and
noncomplementary together.
RC 1 00 ,00 Question Completion Status: Given the figure below, identify the location of the following -25 +1 AAAAAAA 3 A-upstream enhancer TATA Box Transcription start site Enhancer Promoter Primary transcript Click Save and Submit to save and submit. Click Save All Answers to save all answers. Question Completion Status: QUESTION 51 A complementation test was...
Hemoglobin is a protein that is found in red blood cells. It binds to oxygen in the lungs and it carries it to tissues and cells throughout the body. Hemoglobin is made of four polypeptide chains, two called “alpha-globins” (a) and two “beta-globins" (B). The B-globin polypeptide is produced in the cells based on the sequence of the HBB gene. The structure of the HBB gene that codes for beta-globin is represented below. The primary transcript is 1606 nucleotides long....
EXPERIMENT 9: SYNTHESIS OF DIPHENYLACETYLENE Objective: Complete the two-step halogenation/elimination reaction sequence that converts an alkene (trans- stilbene) to an alkyne (diphenylacetylene) PRELAB NOTEBOOK: In the laboratory notebook, write the overall experimental objective, chemical equation(s), reaction mechanism. draw a diagram or outline of the procedural steps, and complete the chemical safety table for all chemicals. 1. Does this elimination process occur via an E1 or E2 mechanism? Justify your answer by explaining the specific factors that differentiate when E1 versus...
Most questions answered within 3 hours.
-
The electron configurations for H2+ and H2
are σg1s and σg21s respectively.
Which will have the...
asked 3 minutes ago -
a
concert loudspeaker suspended high off the ground emits 50 W of
sound power.
what is...
asked 2 minutes ago -
Can you suggest a way for accurately measuring the focal length
of a diverging lens without...
asked 7 minutes ago -
On January 1, 2017, Ellison Co. issued eight-year bonds with a
face value of $3,000 and...
asked 12 minutes ago -
1. Think of an example (from your life, someone you
know, a film, or just invented)...
asked 22 minutes ago -
Identity an industry and explain how they do or could benefit
from having better data quality...
asked 27 minutes ago -
Based on the relationship between basicity and leaving group
abilities, which of the following classes of...
asked 30 minutes ago -
A 3/2 valve represents
a.
3 or 2 ports.
b.
3 or 2 positions.
c.
3...
asked 33 minutes ago -
Give a current example of subordinate group and explain what
makes this group a subordinate one....
asked 45 minutes ago -
Identify an issue of cultural conflict (different from question
two) and the persuaders who are involved....
asked 35 minutes ago -
The three phases of the Calvin cycle are: 1. Carbon fixation. 2.
Reduction. 3. Regeneration of...
asked 53 minutes ago -
Two particles with different charges are on the same
equipotential line. Do these particles have the...
asked 51 minutes ago