Question

please help (no need to explain just give me the answer please) ==> 1) The in...

please help (no need to explain just give me the answer please) ==> 1) The in vitro translation system Nirenburg & Matthaei used to determine the first “word” of the genetic code technically SHOULD NOT have worked because: a) The cell extract technically didn’t contain living ribosomes b) The synthetic polyU RNA added did not contain a ribosome binding site or start codon c) RNA molecules break down too quickly to be effectively translated in a cell-free extract d) The tobacco mosaic virus RNA used in the experiment is the “nonsense” = template strand, not the coding strand

==> 18) 18) When the large ribosomal subunit first binds to the small ribosomal subunit to begin translation, what site is the methionine initiator tRNA located in? a) P site b) A site c) E site d) None of the above, the initiator tRNA exits the ribosome immediately before assembly of the 2 subunits

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans:

1) The in vitro translation system Nirenburg & Matthaei used to determine the first “word” of the genetic code technically SHOULD NOT have worked because:

b) The synthetic polyU RNA added did not contain a ribosome binding site or start codon.

2) When the large ribosomal subunit first binds to the small ribosomal subunit to begin translation, what site is the methionine initiator tRNA located in?

  a) P site.

Add a comment
Know the answer?
Add Answer to:
please help (no need to explain just give me the answer please) ==> 1) The in...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please put the following steps of prokaryotic translation in order from beginning to end. The first...

    Please put the following steps of prokaryotic translation in order from beginning to end. The first step should be denoted a "1", the second step a "2", an so on. If a step is incorrect, do not assign it a number. Answers below [Choose ] Methionine is added as the final amino acid because of its association with the stop codon Initiator tRNA binds to A site mRNA binds to both ribosomal subunits simultaneously Peptidyl transferase is used to build...

  • QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What...

    QUESTION 1 QUESTION 5 QUESTION 11 Identify the components required for translation initiation in bacteria What is the enzymatic component of the ribosome? A Protein Identify the TRANS components of the transcription initiation complex in bacteria ATFIE Bir RNA C. TATA BOX D-10 and 35 sequences E Signa factor B. Carbohydrates C.RNA CATFIE B. 5methyl guanosine cap C. Shine-Dalgamo Sequence D. Sigma factor CETFIID (TBP and TAFS) FTFIIB G. Initiator RNA H.10 and 35 sequences EL Smal ribosomal subunit J....

  • answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of...

    answer all the questions 18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...

  • Please use the drop down menu of answer choices to answer all questions. Reference both picturea...

    Please use the drop down menu of answer choices to answer all questions. Reference both picturea for all possible answer choices. Thanks! 1. At this step in the process of translation the ribosome assemble around the mRNA 2 At this step in translation the tRNA takes amino acids to the ribosomes attached to mRNA_to build a polypeptide chain 3. At this step in translation the ribosome releases the polypeptide chain 4. True/False in prokaryotes translation takes place in the cytoplasm...

  • PLEASE ANSWER ALL QUESTIONS Q1: on the ribosome, the mRNA is read from ____ is a...

    PLEASE ANSWER ALL QUESTIONS Q1: on the ribosome, the mRNA is read from ____ is a series of three nucleutides called_____ a. 5' to 3' ,, Codons b. 5' to 3' ,, anticodons c. 3' to 5' ,, codons Q2: which of the following features of eukaryotic ribosomes in translation initiation is FALSE? a. it uses an initiator tRNA that carries a methaionine b. the large subuinit of the ribosome is important for binding to the mRNA c. the large...

  • I need help answering this question please! x G are stop codons adn terminati x+ ■...

    I need help answering this question please! x G are stop codons adn terminati x+ ■ Course Content A Test Information Instructions Multiple Attempts This test allows 3 attempts. This is attempt number 1. Force Completion This test can be saved and resumed later Question Completion Status: & Moving to another question will save this response. Question 4 Which of the following does not occur during termination of translation? The tRNA corresponding to the stop codon enters the A site...

  • 1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule...

    1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule into single strands. b. The leading strand of DNA is started by an RNA primer The lagging strand of DNA is synthesized as "Okazaki fragments", cach with its own RNA primer. DNA replication proceeds in both directions around the bacterial chromosome. DNA polymerase synthesives new DNA in one direction (3 to 5) only. 2. Which of the following would be found in eukaryotes? a....

  • moose the correct alphabet (letter, noting that each and may have only ch answer can be...

    moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...

  • choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells...

    choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...

  • can you guys please give me the correct answers and explain why? 25. The non-template strand...

    can you guys please give me the correct answers and explain why? 25. The non-template strand of an E. coli gene is the following sequences matches the resulting RNA. Strand of an E. coli gene is listed below. The +1 is indicated. Which of +1 TATAATAGACAGAATTGATGCGTA A. UAUAAUAGACAGA B. TCTGTCTATTATA C. UCUGUCUAUUAUA D. AAUUGAUGCGUA EUACGCAUCAAUU 26. Which of the following statements concerning aminoacyl-tRNA synthetases is correct A. Because the genetic code is degenerate, cells must contain a specific aminoacyl- tRNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT