Question

What would happen in the synthesis of sulfanilamide if the amino group were not protected as an a...

What would happen in the synthesis of sulfanilamide if the amino group were not protected as an amide in the chlorosulfonation step?

If the Amino group were NOT protected, it would do a ____ substitution on chlorosulfonic acid. Later in the sequence, this group ____ be removed without cleaving the other sulfonamide group.

electrophilic; could not
nucleophilic; could not
nucleophilic; could
electrophilic; could
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer is :

If the Amino group were not protected, it would do a nucleophilic substitution on chlorosulfonic acid. Later in the sequence, this group could not be removed without cleaving the other sulfonamide group.

Add a comment
Know the answer?
Add Answer to:
What would happen in the synthesis of sulfanilamide if the amino group were not protected as an a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • use the notes provided to help answer the question above. will rate well The second step...

    use the notes provided to help answer the question above. will rate well The second step of the synthesis transformation of the chlorosulfonyl functional group into a sulfonamide) is an example of a a. Nucleophilic displacement (substitution) b Elimination C. Electrophilic aromatic substitution d. Acid hydrolysis Esterification e. THE SULFONIC ACID GROUP AND ITS DERIVATIVES Sulfonic acids are organic analogs of sulfuric acid, a very strong acid. They are highly corrosive, react vigorously with water, and can cause skin bums....

  • Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th...

    Below is an mRNA sequence and the peptide it encodes. What would happen if the 7th nucleotide were deleted? 5' GCU-UGU-UUA-CGA-AUU 3' Ala-Cys-Leu-Arg-Ile The entire peptide sequence would change The first amino acid would remain the same, but the others would change. None of the amino acids would change. The first two amino acids would remain the same, but the others would change. > Moving to another question will save this response.

  • of alanine has a pk of 9.87. What is the 153, The amino group charge on...

    of alanine has a pk of 9.87. What is the 153, The amino group charge on that amino group at pH 7.0 145. Which amino acid serves as the first amino acid at the hN terminus of a newly synthesized protein? (B) methionine (A) alanine 9.80. The side chain of that amino acid includes (A) an amine group (C) a carboxylic acid group. (D) an alcohol 154. A certain amino acid has a pl (or pH, isoelectric point) (D) threonine...

  • 8. Given what you know about substitution reactions of square planar complexes, explain what would happen in the re...

    8. Given what you know about substitution reactions of square planar complexes, explain what would happen in the reaction (Pt(NH3)4]2+ + Cl → Pt(NH3)3CIJ* + NH3 if the entering group were changed from Cl to Br. How would the rate be affected? Write the mechanism for the reaction (be sure to designate a rate determining step) and draw a reaction coordinate diagram.

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • Imagine a biochemistry lab is testing out a new procedure to improve the synthesis of a...

    Imagine a biochemistry lab is testing out a new procedure to improve the synthesis of a dipeptide molecule made with the amino acids Valine and Threonine. The hypothesis is that acid as a catalyst will improve the condensation reaction between the amino acids and create a greater yield of a dipeptide (molecule formed with these two amino acids). The procedure compares the result of 10 samples using the common older procedure (A) to ten samples using the newer acid synthesis...

  • need help with the boxed bullet point. writing the chemical reaction scheme for the experiment. Synthesis of an A...

    need help with the boxed bullet point. writing the chemical reaction scheme for the experiment. Synthesis of an Alkyl Halide: A Nucleophilic Substitution Reaction, Part I Pre-lab Assignment for Synthesis of an Alkyl Halide: A Nucleophilic Substitution Reaction, Part 1 1. From The Organic Chem Lab Survival Manual ( edition) by Zubrick • Review pages 201-204: Standard Reflux. • Review pages 127-140: Extraction • Review pages 164-189: Distillation, Simple Distillation. The Distillation Example, and The Distillation Mistake. 2. Read this...

  • Do you think it is possible to exploit the biological process of protein synthesis to make...

    Do you think it is possible to exploit the biological process of protein synthesis to make human proteins in the lab? What would you need to do this? Describe the general process you would need to follow to accomplish this goal. NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE Part lIl Chemical Synthesis of Human Insulin - Close, but no Cigar In order to meet the increasing demands for insulin, and to eliminate the adverse side effects of animal insulin,...

  • Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid. Most...

    Use of Modern Molecular Techniques to Determine the Synthetic Pathway of a Novel Amino Acid. Most of the biosynthetic pathways described in our book were determined before the development of recombinant DNA technology and genomics, so the techniques were quite different from those that researchers would use today. Through this question, you will explore an example of the use of modern molecular techniques to investigate the pathway of synthesis of a novel amino acid, (2S)-4- amino-2-hydroxybutyrate (AHBA). AHBA is a...

  • Synthesis using Carbonyla-Substitution Chemistry Preamble This experiment involves the synthesis of target molecules using a-substitution chemistry....

    Synthesis using Carbonyla-Substitution Chemistry Preamble This experiment involves the synthesis of target molecules using a-substitution chemistry. You are assigned two target molecules, one of which is best synthesized by an alkylation approach, while the other is best synthesized by an addition or condensation approach. My two target molecules are number 2 and number 12 in the last page. You must do the following: 1. Perform a retrosynthetic analysis on the two target molecules assigned to you. In each case the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT