Question

DNA analysis of a bacterium that was isolated from a soil sample showed that the bacterium contained 14% adenine. Use Chargaf


DNA analys 14% adenine. Use Chargaffs rule to cormplete the following table for the percent nucleotide composition of the ba
DNA analysis of a bacterium that was isolated from a soil sample showed that the bacterium contained 14% adenine. Use Chargaff's rule to complete the following table for the percent nucleotide composition of the bacterial DNA. [1 marks] Nucleotide Percent composition (% 14
DNA analys 14% adenine. Use Chargaff's rule to cormplete the following table for the percent nucleotide composition of the bacterial DNA. [1 marks] is of a bacterium that was isolated from a soil sample showed that the bacterium contained Nucleotide | Percent composition (%) 14
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:

According to the Chargaff' rule, number of purines (A+G) is equal to the number of pyrimidines (T+C)

A+G= T+C

Nucleotide percent composition (%)
A 14%
C 36%
G 36%
T 14%
Add a comment
Know the answer?
Add Answer to:
DNA analysis of a bacterium that was isolated from a soil sample showed that the bacterium contained 14% aden...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 58) Edwin Chargaff discovered that the nucleotide composition of DNA varies from one species to another....

    58) Edwin Chargaff discovered that the nucleotide composition of DNA varies from one species to another. However, nucleotide composition always follows certain rules. Use these rules to make deductions about the structure of a particular DNA molecule by completing the table below. Nucleotide Presence in DNA sample (%) Adenine Cytosine Guanine thymine 59) Using the data from the table above to draw a stretch of a double-stranded DNA molecule that is 20 base pairs long (hint: in the table above,...

  • 1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...

    1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...

  • For part 1 of this lab) I collected a soil sample from my campus Part 2)...

    For part 1 of this lab) I collected a soil sample from my campus Part 2) Tested bacteria initial viability Part 3) DNA extraction Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA sequence data analysis (sent sample to another lab) 1) What type of conclusions can be made from initially culturing on nutrient agar (e.g., qualitative assessment, quantitative assessment, preliminary, estimate, descriptive, or bacterial diversity)? 2) What...

  • Scenario 1: A bacterium isolated from a wound sample gave the following results: MacConkey agar =...

    Scenario 1: A bacterium isolated from a wound sample gave the following results: MacConkey agar = no growth Mannitol salt agar - good growth, color of medium unchanged Based on these results, which of the following statements is/are true? (Choose ALL true statements.) A. The organism is most likely Gram positive. B. The organism is most likely Gram negative. C. The organism is most likely a bacillus. D. The organism is most likely a coccus. Which of the following most...

  • help me answer these- One strand of a section of DNA Isolated from the bacterium E....

    help me answer these- One strand of a section of DNA Isolated from the bacterium E. cow reads: answer all parts 5- GTAAGCTACGGATAGG -3 A. Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template meaning this is the coding strand). What will be the sequence of the mRNA in this region (make sure you label the 5 and 3' ends of the mRNA)? B. How many different peptides could potentially be made from...

  • Bacteria use DNA methylation as a method to label their DNA, so they can identify foreign...

    Bacteria use DNA methylation as a method to label their DNA, so they can identify foreign DNA and degrade it using restriction endonucleases. This DNA methylation is different than that of eukaryotic organisms, in that it adds a methyl group to adenine. This makes the bacterial DNA methylation system a potential antibiotic target. Question 1: (3 marks) Based on what we learned about enzyme activity and regulation, explain what you would expect for the following enzymes: How would this differ...

  • DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...

    DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...

  • please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing...

    please help!! In-lab Activity on DNA, DNA Replication and Pro Directions: Complete the color key belowing the Key to colors Adenine - blue Replication and Protein Synthesis Name the DNA modelin class. then awer the questions about the mode ThymineONOMI Deoxyribose Oangcor Red 1. Using the nitrogen base letters to repre your color key and this sequence of colors for the sen blue-blue-orange-yellow-orange-yello Cytosine yellow Guanine - Green COLOR CHOICES Yellow Purple Red Green Orange u to represent nucleotides, wide...

  • 1. The type of genetic exchange between bacterial cells that can happen between isolated DNA and...

    1. The type of genetic exchange between bacterial cells that can happen between isolated DNA and a live bacterial cell is: a. conjugation b. transduction c. transversion d. transformation 2. An Hfr strain of E. coli with genotype a+b+c+d+e+f+ is mated with an F¯ auxotrophic strain with the genotype a¯b¯c¯d¯e¯f¯. Conjugation is stopped at 10 minute intervals and the genotypes of the resulting conjugants are determined. The following results are obtained: after 10 minutes e+ after 20 minutes a+ e+...

  • For part 1 of this lab) I collected a soil sample from my campus Part 2)...

    For part 1 of this lab) I collected a soil sample from my campus Part 2) Tested bacteria initial viability Part 3) DNA extraction Part 4) DNA quantification by Nanodrop Part 5) Sample sequencing Part 6) PCR amplification Part 7) Gel electrophoresis Part 8) DNA sequence data analysis (sent sample to another lab) Directions for Part 3 DNA extraction are in the attached image QUESTIONS REGARDING PART 3 (DNA extraction) 1) What type of conclusions can be made from initially...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT