Question

You have access to a polymerase that has a maximum extension of 3kb. Below is a (not to scale) schematic from the paper depic
0 0
Add a comment Improve this question Transcribed image text
Answer #1

You have access to a polymerase that has a maximum extension of 3kb. Below is a (not to scale) Schema g epcting the location

Add a comment
Know the answer?
Add Answer to:
You have access to a polymerase that has a maximum extension of 3kb. Below is a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious...

    You are presented with a 14-year-old patient suffering from Hereditary Infantile Drooling Disorder (HIDD), and insidious disease in which children appear normal until age 14, at which time they begin to drool uncontrollably. Little is known about the genetics of HIDD, so you decide to do a study. You obtain a sample of DNA from the patient and a normal volunteer, and sequence the HIDD gene. The sequences are shown below: Key: Blue = C; Red = T; Green =...

  • You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in...

    You PCR amplify a 500 bp (base pairs) piece of DNA that has diagnostic value in determining whether a patient has a mutation within a specific DNA region. You know that this DNA segment of the “normal” gene does not include an EcoRI restriction site; but the mutated DNA segment of the same gene contains an EcoRI restriction site due to a point mutation at the 100th bp from the 5’ DNA end. After PCR amplification, you subject your DNA...

  • Add SYBR green to the remaining half of each PCR reaction product and perform a melting...

    Add SYBR green to the remaining half of each PCR reaction product and perform a melting curve analysis. slowly increase the temperature of the samples from 60oC to 95oC, recording the fluorescence emitted from each sample with every 5oC increase in temperature. Draw the fluorescence (y axis) versus temperature (x axis) plot that you would expect to see for each product (1 mark each). Specify relevant temperatures for each sample on the x axes of your plots (1 mark each)...

  • 1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...

    1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...

  • Since the 1980s, HIV (Human Immunodeficiency Virus) has been infecting humans around the world causing the...

    Since the 1980s, HIV (Human Immunodeficiency Virus) has been infecting humans around the world causing the condition known as AIDS (Acquired Immune Deficiency Syndrome). HIV, like all viruses, needs to enter cells and use their machinery to reproduce and spread. During HIV infection, the virus enters specific cells of the immune system (T-cells) by "docking" onto cell surface proteins, including one called CCR5 Genetic analysis of individuals who are naturally immune (resistant) to HIV have revealed that resistance to HIV...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • Please complete tables for forensic biology lab using the gel image as reference. If you could...

    Please complete tables for forensic biology lab using the gel image as reference. If you could complete the whole table that would be much appreciated, however I do not expect anyone to do that much work for me. If you could just complete a few rows on each one and show me how you got there, then I'm sure I could complete the rest of it (I'm just confused on how to calculate the distance in cm) My teacher gave...

  • Q2.10. Complete the diagram below by dragging each label to its correct location. When you have...

    Q2.10. Complete the diagram below by dragging each label to its correct location. When you have placed all labels, click Check Answer to get feedback. Any labels that are incorrectly placed will move me diagram Q2.11. The image to the right shows 2 pairs of homologous chromosomes in a cell. Which of the following daughter cells could NOT be produced by normal meiosis? Q2.12. When are sister chromatids (in/from the same chromosome) equivalent to each other? Q2.13. If a person is homozygous for the...

  • 2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...

    2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT