HomeworkLib
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
compared to Fst and assignment methods like STRUCTURE and ADMIXTURE that treat each locus independently (referred...
How I can make a liquid mix yo simulate blood. What essencial susbtances including metabolic waste...
A. You have been given a tube of E. coli. You are asked to make 1...
Describe in detail two ways in which transcription of the trp operon (containing genes used for...
A mixture containing four proteins with native molecular weights: 120 kDa, 100 kDa, 40 kDa, and...
1. Apply the First and Second Law of Thermodynamics to the combustion of glucose and draw...
After going through all the activities, conclude your write up by addressing these two questions. A)interactions...
One of the major issues that Darwin struggled with was the mechanism of how variations were...
The following is a partial DNA coding segment from Homo sapiens CD4 gene that encodes a...
A gene has four alleles, A1, A2, A3, and A4. The alleles occur in a population...
A child's mother has type A blood. Their father has type B blood. The child has...
How can a biologist determine whether a thing is living or nonliving? Discuss the major characteristics...
For the tertiary structure of proteins in an aqueous/polar environment, hydrophobic amino acids are located on...
what is the largest ecosystem in the planet ? a) the great barrier reef b)the intertidal...
How are yeast and molds different both macroscopically and microscopically
Choose three important ideas/concepts in microbiology, and explain why you chose them as important. For each concept...
Why don't all x-linked genes demonstrate the gene dosage effect? Answer in terms of protein levels...
The anti-angiogenic drug Avastin works by binding to and inhibiting the activity of A. VEGF. B....
1. Compare and contrast acquired immune deficiency syndrome and primary immune deficiency. Make sure I can...
Maria has classic hemophilia, an x-linked recessive disease. Could Maria have inherited the gene for this...
What is a caregiver? What do you bring to the early childhood setting as a caregiver?
How is the treatment (azithromycin) for a non-lethal ocular disease (trachoma) affecting mortality in children? Discuss...
1) (3 pts) Short hair in rabbits is governed by a dominant allele L and long...
The offspring of first cousins have an increased chance of combining the same, sometimes deleterious, allele...
How do I use the genetic code to determine the exact codon for an amino acid?...
Consider the structure of alanine in its fully protonated state with a +1 charge. Alanine has...
Describe the process that allow Gram-positive bacteria to be tolerant to harsh environmental conditions. Explain why...
Name three advantages that a seed provides to seed plants that more primitive seedless plants lack
1. The following diagram shows the genetic map for a chromosome. A B C D 10cM...
1.How does the genetic code in the DNA get passed on to the mRNA?
Answer the following questions: A. Name the flower that typically appears first in the Spring and...
A recent cold case was solved involving DNA evidence that identified Arthur Rudy Martinez as the...
Class: Industrial Ecology PATAKI_et_al-2006-Global_Change_Biology Urban ecosystems and the North American carbon cycle 11. What is the...
when Clover seeds are coated with bacteria What does this bacteria do for the clover and...
In response to an apoptotic stimulus, initiator caspases a. degrade procaspases. b. cleave a transcription factor...
Assume that the two UGG codons in the leader sequence of the trp operon are changed...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...
For questions 4-5 assume cytoplasmic male sterility without genetic fertility restoration. What will be the pollen...
The following question is for Cellular and Molecular Biology lab. What is bradford assay. Which dye...
dwraw three concept maps for any body systems in the Human body focusing on three core...
Create a chart: with at least 10 characteristics (more will help you next week).The characteristics must...
30. Which cellular component below is surrounded by a single phospholipid bilayer? A) one cisternae of...
Tell a common property and a different property between each of the following pairs - talk...
4. a) Discuss on RNA editing and its impact in cephalopods. (10 Marks) b) Following 5...
Rabies has a — strand (antisense) RNA for its genome. Describe biosynthesis of this virus including...
Chargaff discovered that the A-T bond has the same width as the G-C bond. What implication...
Drosophila has four recessive genes on four different chromosomes (the fact that they are on different...
Part 1 You have been hired as a consulting microbiologist to help a wildlife ecologist understand...
Plant Structure – internal and external 1) You are given part of a plant that was...
What does it mean if an organism is "antibiotic resistant"? Why/how is this a modern day...
Describe the concept of transcriptional switches and why they are required in prokaryotic and eukaryotic systems.
Discuss possible reasons why transcriptional regulation or post-transcriptional regulation may have evolved for different types of...
What do you expect to see in the largest quantities during a viral infection? a. Basophils....
Draw imprints of stoma of upper epidermis of leaf
1)How many microliters of original sample are required to produce a final dilution of 10-2 in...
During prolonged fasting or the onset of starvation, proteins will eventually be used for energy. Discuss...
A student conducts an investigation in which she dissolves 1 gram (g) each of several substances...
The following is true about protein chaperones except: a. they buffer genetic change by repairing the...
a) Its time to refresh your memory on the different types of DNA mutations. Define the...
1. What is protein structure? 2. Why is it important to know the primary structure? 3....
QUESTION 1 When cells stimulate other cells at long distances, it is referred to as: paracrine...
Describe the features present in a mature eukaryotic messenger RNA (mRNA) and discuss how they facilitate...
genomic DNA extraction proticol queations 1- why is sodium Azide added in wash buffer 2 2-what...
1. During homeostasis what physiological factors need to be balanced within a living organisms
Imagine that you have discovered an enzyme that catalyzes synthesis of asparagine from aspartate and NH3....
What is a challenge that can make it difficult to apply the Phylogenetic Species Concept? Understanding...
Why might you expect facultative anaerobes to accomplish anaerobic respiration in peptone-iron agar deeps when they...
Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...
In C. elegans, lon-2 and unc-2 are recessive mutations that are 8 map units apart on...
What can explain the phenomenon where two different loci only give a phenotype when they are...
Steve, a 48 year old accountant, exhibits all the symptoms of metabolic syndrome. Briefly name the...
What would have happened if we had adjusted the pH of our IDH extract to 4.5...
A chromosome’s gene sequence that was ABCDEFG before damage and ABCFG afterward is an example of
If given 285mL of a diluted glucose solution 0.75% (w/v) that was made by adding 35mL...
You are studying three linked genes in snapdragons. The flower color locus is in the center....
Introductory Assignment: Address the following in a handwritten paragraph of a least 500 words. Hemophilia B
1. birds are most closely evolutionarily related to what other partially marine creatures? crocodilians marine iguanas...
What process requires contact between the donor cell and the recipient cell? A. transformation B. transduction...
Why are non-viral vehicles often lipid based? Describe how cationic liposomes can specifically target DNA.
all these questions have more than one correct answers 1) Meiosis & mitosis have similarities as...
‹
1
2
...
60
61
62
63
64
65
66
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
Active Questions
Where is the error in this code sequence? String s1 = "Hello"; String s2 = "ello";...
asked 11 months ago
Financial data for Joel de Paris, Inc., for last year follow: Joel de Paris, Inc. Balance...
asked 11 months ago
Consider this reaction: Al2(SO4)3 (aq)+ BaCl3 (aq) Al2Cl6 (aq)- + 3BaSO4(s) . What is the...
asked 11 months ago
Suppose that Savneet is considering increasing her recent random sample from 20 car rentals to 40...
asked 11 months ago
Trucks arrive at an unloading terminal at an average rate of 120 per hour. Trucks arrive...
asked 11 months ago
Why are methanol and ethanol completely soluble in water while octanol is not very little soluble....
asked 11 months ago
A facilities manager at a university reads in a research report that the mean amount of...
asked 11 months ago
When the CuSO4 is rehydrated by adding water to the anhydrous compound, is this an endothermic...
asked 11 months ago
A ray of sunlight is passing from diamond into crown glass; the angle of incidence is...
asked 11 months ago
A block of mass 0.249 kg is placed on top of a light, vertical spring of...
asked 11 months ago
how do the kidneys compensate in the presences of acidosis a) trigger hyperventilate b) reserve acid...
asked 11 months ago
Question 501 pts The rental rate of capital to the firm increases. Which of the following...
asked 11 months ago
ADVERTISEMENT