HomeworkLib
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
Describe the role of federal, state and local government in preventing and controlling drug abuse
Mitochondria 7.4 micrometers long is found in human and animal cells. Chloroplast 0.8 nanometers long is...
Explain how homeostasis of body temperature is maintained when a person is outside on a cold,...
For the following 3 tables determine the: 1. the probable mode of inheritance of each phenotypic...
Explain why different cells can perform different functions even though they have identical organelles
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the...
For Drosophila Melanogaster how to determine whether the loci are assorting independently (lets say we are...
Which of the following determines the tropism of a pathogen? A. Cell shape B. Ribosomal Structure...
Describe how protein kinases and phosphates change the activity of downstream proteins and explain what is...
Briefly, synthesize the etiology, signs and symptoms, diagnostic tests, and treatment of "ONE" of the common...
1. If tryptophan interacts with a repressor protein (which it does in real life) and the...
A blue whale’s heart pumps ∼20 liters of blood per second through its aorta, which has...
Summarize the possible role of archaea in human health and disease
Draw the following pedigree from the following history. Carlos is a normal individual with an affected...
Transmission light microscopes are not perfect, what is/are its limitations? (a) the Angstrom of light limits...
The venom of the Desert Grass Spider (Agelenopsis aperta) contains a peptide, ω-Agatoxin, that potently blocks...
different types of viruses have different nucleic acids as their genetic material.for each type, trace the...
Keratinocytes are? A) The most abundant cell type in the epidermis B) Found throughout all epidermal...
The difference between genes affecting qualitative and quantitative traits is considered to be simply based on...
Code the procedures/services, and diagnosis(es) for each of the following case scenarios. Be sure to include...
High levels of what hormone increases the likelihood of fraternal twins?
Infectious diseases can emerge through genetic, social and behavioural changes in the host and/or pathogen. Provide:...
how does mutation rate affect the equilibrium value of the recessive allele ? how does complete...
A halophile would ______________ in a high salt environment. Multiple Choice undergo plasmolysis undergo osmotic lysis...
Write a introduction talking about air pollution and explain why its important.
Electrical signals move through the mammalian heart in a particular order. Which order is correct? A....
client who has GERD. Clinical Case: Mrs. G. is a 45-year-old female arrives at the emergency...
Questions? BIOTECHNOLOGY: Describe and explain what restriction enzymes are? what their important characteristic are, and how...
What trade-off did Zink (2003) observe in treehoppers? Females that provided abundant care to their first...
a black coat strain of cattle is crossed with an albino strain. The F1 are brindle...
Some of the plasmids in the “expmt” sample had the gene of interest inserted backwards. How...
A chemical signal can have different effects in different tissues, depending on the receptor type to...
A red blood cell is removed from a person and put into a beaker containing a...
Read and summarize the reasons each of the sociologists, sociobiologists and psychoanalyst brings up to justify...
6. Which of the following is a critical assumption of the Trivers-Willard hypothesis: offspring condition depends...
1A) Two autosomal genes control horn color in dragons. Pure-breeding gold-horned dragons were mated to pure-breeding...
In German cockroaches, a curved wing (cv) is recessive to a normal wing (cv+), A homozygous...
1 why is toxoplasma is deadly to an Aids patient 2 plasmid and it function 3...
Does a homozygous cross tell us anything about where the genes are with respect to the...
. (a)What is genetic discrimination? Provide an example. (b) What protections are provided to individuals by...
Can someone help me answers these? These questions can have one answer, more than one answer,...
NAD+ and FAD are created from certain B vitamins that you obtain in your diet. Although...
8. How many haploid sets of chromosomes are present in an individual cell that is pentaploid...
Using Tinbergen’s framework explain how and why nonbreeding casts can persist in eusocial species?
Describe the strengths/weaknesses of a michaelis menten and line weaver burk plots
Ethyl methanesulfonate and nitrous acid are chemical mutagens. What does each do? Explain in as much...
7) Describe three ways variation can be introduced into offspring produced by sexual reproduction. IN DETAIL...
(Please justify your answer) The human immune system can generate approximately 10^5 different heavy chains and...
You are given two tubes. one is a broth culture of Streptococcus pyogenes and the other...
Most fish and amphibians do not provide parental care, but most birds and mammals do. What...
How does a sea star crawl? If you put a sea star in a vacuum (assuming...
Genetics: What is the expected phenotype of the following mutants, either inDrosophila melanogaster or in Arabidopsis...
Two species of foxes are observed to have overlapping geographic ranges. Describe how this speciation event...
In the Spring of 2009, a novel H1N1 virus emerged that had a new combination of...
A patient is having surgery performed and a large amount of blood has been lost during...
1. a) The Pocono Lakes region is ____ in the nation when it comes to acid...
what is the term given to the enlarged area at the anterior end of the trachea
in a given population, the value of q squared is .13, solve for q.
You are a drug designer. You have developed a drug that needs to work inside cells....
In 1905, scientist Lucien Cuénot carried out multiple crosses with yellow and non- yellow colored mice,...
1. Beadle and Tatum used which of the following organisms to support their one gene one...
1. Describe a typical protein-protein interface, and what is required to allow for protein interactions. 2....
You are accompanying your friend while she does her shopping. Before long, she asks you to...
Bioluminescence in Vibrio fischeri is dependent on A.) phosphorylation of CheY protein B.) autoregulation of the...
1. _____ process involve the building up of end products a. proteolytic b. anabolic c. catalytic...
Carbon is introduced into the atmosphere by all but which of the following means? a. respiration...
After surgery to remove a melanoma, in which associated lymphatic vessels were also removed, what temporary...
Why are researchers unable to give and single number to the length of the human genome?
Mitochondrial oxidative respiration is used to produce two major forms of energy, what are they and...
Made up amino acids Bleucine and Isobleucine are synthesized in a series of steps from made...
I did a simple experiment regarding osmosis and the rate of diffusion along a concentration gradient....
Describe the principles of vaccination and/or immunization. When would it be more effective to inject a...
Draw the appropriate titration curve for Ala-Arg-Serstarting at a pH of 1 and ending at a...
The RNA meets with the organelle ___________________ that will read it to build a polypeptide chain...
write about : the Role of Human mesenchymal stem cells in tissue engineering please, not handwriting.
Which of the following is NOT true about bacterial conjugation An F factor drives replication and...
Describe rain water harvesting grey water harvesting preparation of drinking water from these water sources
Please devise an experiment that you could use to quantify bacterial growth using only light. Be...
1. The action of __________ result in the antibody immune response. a. B lymphocytes. b. neutrophils....
Consider a culture of E. coli growing in exponential phase with a generation time of 20...
‹
1
2
...
64
65
66
67
68
69
70
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
Active Questions
Where is the error in this code sequence? String s1 = "Hello"; String s2 = "ello";...
asked 11 months ago
Financial data for Joel de Paris, Inc., for last year follow: Joel de Paris, Inc. Balance...
asked 11 months ago
Consider this reaction: Al2(SO4)3 (aq)+ BaCl3 (aq) Al2Cl6 (aq)- + 3BaSO4(s) . What is the...
asked 11 months ago
Suppose that Savneet is considering increasing her recent random sample from 20 car rentals to 40...
asked 11 months ago
Trucks arrive at an unloading terminal at an average rate of 120 per hour. Trucks arrive...
asked 11 months ago
Why are methanol and ethanol completely soluble in water while octanol is not very little soluble....
asked 11 months ago
A facilities manager at a university reads in a research report that the mean amount of...
asked 11 months ago
When the CuSO4 is rehydrated by adding water to the anhydrous compound, is this an endothermic...
asked 11 months ago
A ray of sunlight is passing from diamond into crown glass; the angle of incidence is...
asked 11 months ago
A block of mass 0.249 kg is placed on top of a light, vertical spring of...
asked 11 months ago
how do the kidneys compensate in the presences of acidosis a) trigger hyperventilate b) reserve acid...
asked 11 months ago
Question 501 pts The rental rate of capital to the firm increases. Which of the following...
asked 11 months ago
ADVERTISEMENT