Question

9. Starting with a single bacterium, what is the minimum number of rounds of division required to exceed one million cells, a

0 0
Add a comment Improve this question Transcribed image text
Answer #1


Solu- cliven- No. of bacteriums Minimum number of division require - exceed one million cells. By assuming binary fission fo

Add a comment
Know the answer?
Add Answer to:
9. Starting with a single bacterium, what is the minimum number of rounds of division required...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A single Staphylococcus aureus bacteria cell gets into a wound on your foot. S. aureus divides...

    A single Staphylococcus aureus bacteria cell gets into a wound on your foot. S. aureus divides by binary fission approximately once every 30 minutes (doubling time). Mutations occur at a rate of 1 per 1010 base pairs per generation. S. aureus has 2.8 x 106 base pairs in its genome. Therefore, approximately 0.0028 mutations will occur per bacterium in the population. As a Gram-positive bacteria, will this infection be susceptible to antibiotics? Explain your answer (reference one of the three...

  • Please use C++, thank you! The life game consists of a board with size of NxN cells and cells are occupied by creatures. Each cell can have at most one creature. The surrounding cells are called the...

    Please use C++, thank you! The life game consists of a board with size of NxN cells and cells are occupied by creatures. Each cell can have at most one creature. The surrounding cells are called the neighbors of this cell Each game state is called "generation". The game progresses from one generation to the next according to the following rules: A creature that has more than 3 neighbors- dies of crowding. Its cell will be empty in the next...

  • Question 2: The Atlas blue butterfly has 224 homologous pairs of chromosomes. Each pair consists of...

    Question 2: The Atlas blue butterfly has 224 homologous pairs of chromosomes. Each pair consists of one chromosome from the butterfly's mother and one from its father. A. Assuming no crossing over, what is the probability that a sperm this butterfly makes has all of the chromosomes from the butterfly's own father? Why? (You do not need to calculate out this number- a number with an exponent is fine.) (roughly 3-4 sentences) B. How many chromosome 17's does this butterfly...

  • Division from last year. The Controller has asked you to compute the ROI and Residual Income...

    Division from last year. The Controller has asked you to compute the ROI and Residual Income based on data from last year and if the division adds a new product line. Use the Information Included in the Excel Simulation and the Excel functions described below to complete the task. . Cell Reference: Allows you to refer to data from another cell in the worksheet. From the Excel Simulation below. If in a blank cell. "=G5" was entered, the formula would...

  • This is for C++ The mathematician John Horton Conway invented the “Game of Life.” Though not...

    This is for C++ The mathematician John Horton Conway invented the “Game of Life.” Though not a “game” in any traditional sense, it provides interesting behavior that is specified with only a few rules. This project asks you to write a program that allows you to specify an initial configuration. The program follows the rules of Life (listed shortly) to show the continuing behavior of the configuration. LIFE is an organism that lives in a discrete, two-dimensional world. While this...

  • Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...

    Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...

  • A cell's genome is its blueprint for life. However, what is the bare minimum number of...

    A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...

  • this is a very tough homework assignment for my environmental biology course so if everyone could...

    this is a very tough homework assignment for my environmental biology course so if everyone could please help me I would greatly appreciate it because I have no access to tutors to check my work. which of the following is correct about binary fission? A) It is a common type of microbial cell division. B) Daughter cells are identicals. C) It leads to a microbial population. D) All of the above To decide if you should replace the existing antibacterial...

  • 2. Let's now use Excel to simulate rolling two 6-sided dice and finding the minimum of...

    2. Let's now use Excel to simulate rolling two 6-sided dice and finding the minimum of both dice. • Create a new Excel sheet in your document. Click on cell Al, then click on the function icon f. and select Math&Trig, then select RANDBETWEEN. In the dialog box, enter 1 for bottom and enter 6 for top. • After getting the random number in the first cell, click and hold down the mouse button to drag the lower right corner...

  • LAB EXERCISE 5.1 continued The top row in the table below is an example for one...

    LAB EXERCISE 5.1 continued The top row in the table below is an example for one couple's results. One parent e is heterozygous (one red, one yellows: AA). The dice roll determines yellow: AS) and the other homozygous for the normal hemoglobin allele (two that they will have four children. Creating Generation 2 Offspring Genotypes CoupleNumber of children Sample ASIAA | AA | 10 12 13 14 15 16 17 18 19 20 3 List the number of genotypes for...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT