A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did the scientists at JCVI suspect that it would take 20 years to satisfy their scientific curiosity!
Instead of beginning by genetically manipulating a
Mycoplasma species, microbiologists at JCVI wanted to have
more control. To begin unraveling the genetic requirements for
life, they first generated a synthetic self-replicating
Mycoplasma (described in this chapter). The genome of this
pioneering synthetic life form was synthesized from scratch based
on its known genome sequence. The synthetic cell did not possess a
"designer genome," or even a minimal one; it simply contained its
own genome, but one completely constructed in the laboratory. This
breakthrough in synthetic biology provided the technology needed
for microbiologists to create designer genomes.
Using comparative genomics and prior knowledge about specific gene
sequences, microbiologists at JCVI continued their work by
designing and synthesizing several minimal genomes that they
hypothesized would sustain life. To their dismay, none of these
resulted in a viable cell. So instead, they generated modules of
DNA corresponding to a Mycoplasma genome and sewed
different combinations together to form synthetic genomes. Once
viable cells were obtained from transplanting these genomes,
nonessential genes from the smallest genome were identified by
transposon mutagenesis. After removing these unnecessary genes, a
synthetic minimal cell coined JCVI-syn3.0 was created (see photo).
This autonomous life form possesses a 531-kilobase genome encoding
473 genes; JCVI-syn3.0 thus contains a genome smaller than any
other free-living cell.
While this work showcases the amazing advancements in synthetic
biology and the potential for creating designer cells with novel
functions, a surprising mystery surrounds this minimal cell: The
roles for almost a third of JCVI-syn3.0's genes remain unknown,
highlighting how much we still need to learn about the genetic
foundation of a living cell.
1. The introductory passage describes work to develop increasingly synthetic cells. What are some reasons that researchers are so interested in developing synthetic life, as opposed to simply developing more approaches to work with existing species of organisms? You should speculate about realistic options, as these are not all listed in the chapter.
Select all that apply.
| Synthetic cells will allow researchers to determine the minimum number of genes necessary for a cell to function. |
| Synthetic cells can be modified to facilitate their use for a wide variety of manipulations (e.g., by inserting convenient restriction sites). |
| Synthetic cells will always divide more rapidly and be more easily cultured than existing cells. |
| Synthetic cells can be used to make products, which cannot be done with current techniques using genetically modified cells. |
2. Which of the following is NOT an example of an impediment to the development of entirely synthetic cells, beyond even JCVI-syn3.0?
Select all that apply.
| Researchers have been unable to create functional cells by combining individual genes in a planned pattern, but only by combining DNA modules. |
| Researchers do not know the function of all of the genes necessary for life, meaning that even JCVI-syn3.0 has genes of unknown function. |
| It has been impossible to distinguish the transformed Mycoplasma cells from the non-transformed Mycoplasma cells. |
| Researchers have been unable to create all cell components from scratch; they have only been able to insert DNA into existing cells (transplanting the genome). |
| Transposon mutagenesis cannot be used to inactivate genes; it can only be used to add new genes to an organism. |
Before JCVI-syn3.0 was produced, what steps were used to create a synthetic Mycoplasma cell? Put the events below into the correct order.
place the events into the proper sequence from left to right. first step to last step.
|
The synthetic chromosome Transformed cells are Yeast is transformed DNA fragments The synthetic 4. In the chapter, transformed Mycoplasma cells are identified because they produce a blue color. There are other ways to identify cells that have taken up genetic material. For example, a piece of DNA containing genes for green fluorescent protein (GFP) and a yeast DNA-binding protein gene is used to identify yeast nuclei. What is the name for this construct?
5. Drag the choices below to indicate whether each represents a statement about genomic editing or a statement about synthetic biology.
|
6.
The polymerase chain reaction (PCR) is a powerful tool for amplifying genetic material (i.e., making many copies of it). This technique can be used for a wide range of applications. What are the steps of PCR required to amplify DNA?
Drag and drop the events into the proper sequence from left to right. first to last step
|
A probe is used to The sample is The sample is heated The product is Cycles of heating and DNA must be The sample is heated, |

A cell's genome is its blueprint for life. However, what is the bare minimum number of...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
1 What is an imprinted gene? Select one: a. A gene that is found on a Barr body b. A gene that is silenced upon inheritance from a designated parent c. A gene that is inherited from only one parent d. A gene that is encoded on only one of the two copies of a chromosome Question 2 Which of the following is NOT a typical characteristic of cancer? Select one: a. Malignant cancers are typically not able to metastasize...
and w Two-dimensional gel electrophoresis separates proteins based on a. shape; charge Ob.size; concentration c. concentration; shape O d. size, charge O e. size; shape Refer to the table. Several strains of a bacterium are sequenced to investigate the pan and core genomes. In the table, + denotes presence of the gene and denotes its absence. Gene Gene Gene Gene Gene Strain ! Strain 2 + Strain 3 + Strain 4 + + + + Strain 5 + + What...
Please answer all the questions (1-6) Thank you. I’ll be sure
to leave you a like :)
check Your Understanding 5. How does the mutated CFTR protein contribute to What is the difference between genetic engineering and cloning a. Genetic engineering is governed by an international cystic fibrosis? a. The mutation prevents the channel protein from moving chloride across the membrane, resulting in a thick, sticky mucus ethics committee. Cloning does not have any formal ethics oversight. b. The mutation...
13. What are TWO of the insights Watson and Crick had with respect to the structure of DNA? a. DNA is a double-stranded helix held together by A:T or C:G base pairs b. DNA is a helix and has A:T or C:G base pairs c. DNA is a double-stranded helix and the amount of A=T and of G=C d. DNA has two strands in opposite orientation and the amount of A=T and of G=C 14. Griffith's experiment injecting a mixture...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
25. Mendel's factors undergo segregation and independent assortment. How is this illustrated in the chromosomes during Meiosis I? 26. Explain how these inheritance patterns are considered non-Mendelian. Incomplete Dominance . Multiple Alleles • Codominance X-linked Linkage . Pedigrees - Genetic Disorders 27. What is non-disjunction and how does it affect the chromosome distribution during meiosis? 28. What is a karyotype and what does it allow you to do? 29. Fill in the circles and squares to illustrate the following inheritance...
What were the technologies that had to exist for this technology to be developed? What technologies were developed to support? Who developed the technologies? Mouse pups with same-sex parents born in China using stem cells and gene editing Researchers at the Chinese Academy of Sciences were able to produce healthy mice with two mothers that went on to have normal offspring of their own. Mice from two dads were also born but only survived for a couple of days. The...
please answer All the multiple choice questions in the pic (all
pics) i dont need a explantion .
22 Using a bacteriophage to pass DNA rom bacterium to another O A) Transduction O B) Transformation C) Translocation O D) Translation 23. What research did Rosalind Franklin contribute to the elucidation of the double helix structure of DNA? O O O A) Principles of base pairing B) Biochemical data C) Bacterial transformation data D) X ray crystallography A segment of DNA...