
help plz DNA ligase: Creates 3-5 phosphodiester bonds Has sequence specificity in the same manner as...
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
please answer all
amils A Doon E Conjagants DNA hips o sloning of freign DA fa ts are called C Clne D Vecto 20 Whatkind of termini is produced by the retriction endonelease Prl, which restriction site has is 5CGATIC (1he dowswd aow represents the site of cleavage in each strand) D Reverse ends E Polylinker termini A.Y ovehan Byaverhang C Blant ends 21.Eeryme dhat cleave DNA at seuence-specifie sites is called D Exonuclease E Integrase A DNA polymerase Ligase...
Molecular Bio lab. HELP!!
Here is the first part: the sequence traces and the entire
sequence. i just need the last 3 tasks. i color coded the ends so
you can see where it overlaps and connects
In the files section for your group there is a simulated output from an automated DNA sequencer using a variation of the classic Sanger method. (If you want to print it, it is formatted for legal sized paper.) This sequence encodes a protein...
24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
answer all pls
5 Figure K 3 19. Which of the bonds in Figure K above are hydrogen bonds? A. 1 only B. 1&2 C. 2 only D. 3 only E. 4 only 20. What macromolecule is shown in Figure K above? A. A protein B. DNA C. A triglyceride D. A carbohydrate E. RNA Figure M CH3 он NH2 21. How many asymmetric carbons does the molecule in Figure M have? A. 3 B. 2 C.4 D.1 E.O 22....
i
need help with the whole page!
8. You try to ligate a cDNA fragment with Bgl Il and Xho I sticky ends into the Bgl Il and Xho I sites in the multi- cloning site of a vector (vector plus insert: 7 kbp). The plasmid vector has an ampicillin resistance gene. What do you see on the plate next day if you spread the transformed bacteria on an LB agar plate with ampicillin- (1) bacteria with no vector, (2)...
LAB17 Genetic Engineering of Bacteria Problem Is it possible to transfer the allele for resistance to the antibiotic ampicillin into a bacterial cell? Objectives After completing this lab, the student will be able to: 1. Demonstrate micropipetting and sterile pipetting techniques for handling and transferring bacteria and plasmid DNA. 2. Maintain sterile conditions for culturing bacterial cells. 3. Inoculate bacteria into flasks, culture tubes, or agar plates. 4. Culture isolated individual colonies from an agar plate to form genetically identical...