24) TGG would be the anticodon if the template strand of the DNA ACC because we know that A binds with T while G binds with C .
25)Prior to protein synthesis , the DNA serves as a template for creation of mRNA (in a process known as transcription)
26)Human Genome Project has revealed that human DNA approximately has 3 billion bases (which are present in the 23 pairs of chromosomes within the nucleus of all our cells )
27) Organisations which sets the guidelines for genetic engineering are CDC,NIH , MMWR , A&C
28)The vector which is used to insert DNA into a cell must have the ability to reproduce fast , form clones and also be able to self replicate.
29)Restriction enzymes occur naturally in bacteria
30)A population of genetically identical that share a common ancestor is called clone.
31)The so-called "sticky end" of a DNA fragment that has been cut up by the restriction enzymes consists of a particular sequence of exposed,single-stranded nucleotides .
32) The polymerase chain reaction is used to amplify certain sections of DNA
33) Vector -- a carrier used to transfer foreign DNA into a cell
34) sickle cell anemia
35) red-green color blindness
36) ABO blood grouping in humans
37) heterozygous
38) hybrid -- cross result of of two different true breeds
Matching
39) Recombinant DNA -- Hybrid DNA from two sources
40) cDNA -- DNA made using mRNA and reverse transcriptase
41) gel electrophoresis
42) Restriction enzymes -- Cut double-stranded DNA at specific nucleotides
43) sticky ends
44) PCR
45) clone
46) plasmid -- extrachromosomal genetic structure in bacteria that can replicate independently
47) genomic library
48) RNA polymerase
49) 64,61,3
50) DNA
SHORT ANSWERS AND ESSAYS
1)In general, DNA consists of two polynucleotide chains that are wound around each other to form a double helix structure . The two chains are held together by complementary base pairing; that is, specific bonding between A and T bases and between G and C bases on the two strands.
Both the strands of DNA double helix structure can grow in 5' to 3' direction but instead they grow in opposite directions due to opposite orientation of the sugar molecule present in them.This antiparallel orientation allows for the base pairs to compliment one another. Antiparallel DNA is also more structurally stable than parallel DNA.
2) The process how the DNA codes for protein is mentioned step by step :
Thus we can see how DNA codes to form protein
3) To ensure the accuracy of DNA replication the cell has various mechanisms . Out of these ,the first mechanism is the usage of a faithful polymerase enzyme that can accurately copy long stretches of DNA. The second mechanism is that in which the polymerase catch its own mistakes and correct them. Stem cells have an extra safeguard to preserve the accuracy of their genetic information. DNA is double-stranded. The strands split apart and serves as templates for new copies. Every time when a stem cell replicates its DNA and gets split into two cells, the cell that remains a stem cell will keep the same strand of DNA. This strand is called the mother strand or the immortal strand. In this way, the stem cell can preserve the original copy of its DNA.
Another characteristics for ensuring the accuracy of DNA replication can be attributed to the fact that there is proof reading mechanism by DNA polymerase III which proof reads and corrects is own mistakes while copying and fix them.
24. What would be the anticodon if the template strand of DNA Is ACC A UCC...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
why is E the answer
Below is the genomic DNA of gene X, a 3 exon gene that encodes a 131 amino acid single pass transmembrane protein. Shown are the transcriptional start site, splice donor, acceptor and branch sites and translational start and stop codons. Transcriptional start EXON 1 INTRON 1 EXON 2 INTRON 2 EXON 3 Spfice Donor Splice Acceptor Polyadenylation signal Branch point 17. Treatment with ethidium bromide, an intercalating agent, caused DNA polymerase to add an extra...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
50) During DNA DNA? replication, which of the following enzymes covalently connects segments of A) helicase B) DNA polymerase III C) ligase D) DNA polymerase I E) primase 51) The nitrogenous base adenine is found in all members of which of the following groups of molecules? A) proteins, triglycerides, and testosterone B) proteins, ATP, and DNA C) ATP, RNA, and DNA D) glucose, ATP, and DNA E) proteins, carbohydrates, and ATP 52) A particular triplet of bases in the template...
9. An alteration in the nucleic acid sequence in which a specific restriction endonuclease cuts can be detected by a. ELISA b. flow cytometry c. RFLP d. FISH 10. Which of the following techniques enables the identification of a particular sequence of nucleic acid on a cell or tissue? a. northern blot b. western Blot c. FISH d. southern blot 11. The polymerase chain reaction is used to a. convert RNA back into DNA b. amplify a target nucleic acid...