Question

Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT involve: A. Excision of non-cod
0 0
Add a comment Improve this question Transcribed image text
Answer #1

C. Except charging ofan amino acid residue to CCA end

And the all above are the post translational method of primary mRNA that convert it into mature mRNA

Silencing:-removal of introns and joining of codon

Methylation

Polyadenylation

Add a comment
Know the answer?
Add Answer to:
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...

    Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...

  • What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a....

    What is the function of the 3' poly-A sequence in eukaryotic mRNA? Select one: O a. Intron splicing signal. O b. Initial attachment site for ribosomes. O c. Translation termination. O d. Protection from cytosolic enzymes. What is the function of the 5' cap in eukaryotic mRNA? Select one: O a. Polyadenylation of the 5' end of the mRNA. b. Intron splicing signal. O c. It must be on the mRNA in order for the mature mRNA to be exported...

  • would the first one be D and the second one C? "The processing of some tRNA...

    would the first one be D and the second one C? "The processing of some tRNA molecules, like that of most mRNA molecules, involves the addition of a poly-A tail at their 3' end the addition of a poly-A tail at their 5' end the addition of a CCA sequence at their 5' end the addition of a CCA sequence at their 3'end the alternative deletion of random segments splicing "In general, are the longest RNAs produced in eukaryotic cells"...

  • a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA...

    a piece of eukaryotic DNA is shown below:                      5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.

  • QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False...

    QUESTION 1 RNA poll initiates synthesis of the mRNA transcript without a primer True O False QUESTION 2 En The +1 position identifies the location for translation to begin when bound the mRNA is bound by the ribosomal subunit. True False QUESTION 3 The small ribosomal subunit binds the mRNA transcript at a sequence that is complementary to the gene promoter in order to initiate translation. O True False QUESTION 4 The 5' cap is necessary for protection from exonuclease...

  • QUESTION 5 Match these terms to the descriptions below. b. , is added onto mRNA during...

    QUESTION 5 Match these terms to the descriptions below. b. , is added onto mRNA during processing d , proteins that help initiate RNA synthesis a. spliceosome b. cap c. telomere d. transcription factors e. promoter a, removes introns from primary RNA transcript TATA-rich DNA sequence indicating the start site of a gene c repeating sequences found at the ends of linear DNA

  • Not sure where I am going wrong. Each type of pre-mRNA processing has one or more...

    Not sure where I am going wrong. Each type of pre-mRNA processing has one or more important functions. Match the function with the appropriate type of processing XAddition of 5' cap Addition of poly(A) tail RNA splicing enables movement of mRNA out of the nucleus increases mRNA stability through addition of many non-DNA-templated nucleotides facilitates binding of ribosome to beginning of mRNA involves cleavage of RNA downstream of AAUAAA consensus sequence removes non-coding regions from pre-mRNA increases mRNA stability through...

  • Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides...

    Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: O addition of the poly A tail O removal of exons O splicing O addition of the 5' cap Question 7 (1 point) Which of the following recognizes the promoter region of a gene in E. coli allowing RNA polymerase...

  • 25. Which of the following is not true concerning eukaryotic mRNA processing (A) addition of a...

    25. Which of the following is not true concerning eukaryotic mRNA processing (A) addition of a 3' poly-A tail (D) occurs in the nucleus (C) intron splicing (B) addition of a S' cap (E) occurs in the cytoplasm 26. Which of the following is involved in maintaining lysogeny in (A) PRE (B) PRM (C) PRI (D) PRO (E) all of the choices are correct Use the following diagram to answer questions 27-28. Each circle represents a DNA molecule and the...

  • QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to...

    QUESTION 13 What chemical group is at the end of an amino acid chain corresponding to the 3' end of the mRNA molecule? A. Peptide bond B.5 phosphate group C.3" hydroxyl group D. Amino (N-terminus) E. Carboxyl (C-terminus) QUESTION 14 Which of the following is true regarding pre-mRNA modifications/processing? O A. Alternative splicing allows for increased complexity and synthesis of protein isomers OB. The 5' cap is added after RNA polymerase dissociates from the gene OC. The poly A tail...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT