Question

for the anneal olignucleotides to get double strand DNA from single strand DNA heat the beaker...

for the anneal olignucleotides to get double strand DNA from single strand DNA heat the beaker and cooling overnight why? why we do not use the PCR thermocycl?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

For annealing oligonucleotides to get double strand from single strand, it is boiled for breaking unnecessary hydrogen bonds and attachment of primer. After the primer is attached on overnight cooling the remaining nucleotides are added by hydrogen bonds.heating for breaking hydrogen bonds and cooling for forming hydrogen bonds.

In PCR the double stranded DNA is denatured to form single stranded DNA. But DNA in this case is already single stranded. So it is not subjected to PCR since it is a cycle starts with denaturation of double stranded DNA. It is not needed for this case of annealing.

Add a comment
Know the answer?
Add Answer to:
for the anneal olignucleotides to get double strand DNA from single strand DNA heat the beaker...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • Below is a single strand of a DNA duplex. Please write down the sequences of the...

    Below is a single strand of a DNA duplex. Please write down the sequences of the forward and reverse primers that will anneal to the areas of the duplex represented on this strand in bold? Write these primers down 5'-3' (2 marks Primer 1 Primer 2 5'-ATGGATCGATACGGTAACGATCTCTCTCATGCTTTGGACACGAAAGGCATTCT-3' Primer 1 = Primer 2 = Then estimate the approximate Tm of primer 1 and primer 2 (2 marks). Primer 1 Tm = Primer 2 Tm =

  • DNA replication    All choices are correct.     duplicates chromosomes     uses a single strand of...

    DNA replication    All choices are correct.     duplicates chromosomes     uses a single strand of a DNA molecule as a template for the creation of a new double strand.     is carried out the DNA polymerase.

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows...

    In DNA replication, the ________ strand grows towards the replication fork, while the ________ strand grows away from the replication fork. mRNA; leading leading; lagging leading; template lagging; template lagging; leading Which of the following is not necessarily related to tumour formation? an overactive MYC gene proto-oncogenes inactive tumour-suppressor genes cell de-differentiation metastasis The total number of unique, three-base combinations of the four nucleic acid bases in DNA is 12. 16. 20. 64. 256. The purpose of cloning is to...

  • QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...

    QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...

  • During DNA replication, because each of the double stranded molecules of DNS consists of a single...

    During DNA replication, because each of the double stranded molecules of DNS consists of a single strand of old DNA (parent strand) and a single strand of new DNA (daughter strand), DNA replication is also known as: • A) Origin of replication • B) Replication bubble • C) Semi-conservative replication • D) All of the above

  • 1. The kinetics of the single-step formation of a DNA double strand were measured for the...

    1. The kinetics of the single-step formation of a DNA double strand were measured for the reaction: 2 CGGAATTCCG (CGGAATTCCG), a) From the table of experimental data below, calculate AH, AS, and AG for the forward and reverse reactions Temperature (°C) kforward (10 M S ) kreverse (s) 31.8 1.00 36.8 2.3 3.20 41.8 15.4 46.7 87.0 0.8 3.5 6.0 b) Calculate AH, AS, AG, and Keq for the overall reaction at 37 °C. Hint, from the forward and reverse...

  • 20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded...

    20. Which enzyme separates the strands of the DNA helix? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 21. Which enzyme joins newly synthesized DNA fragments on the lagging strand? A. DNA Polymerase E. Single Stranded Binding Proteins B. Ligase F. Primase C. Helicase G. Lagging Strand D. Topoisomerase H. Leading Strand 22. In a PCR reaction, at which temperature do the two strands of DNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT