Question

Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how th
0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus poin...

    Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)? Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?

  • Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

    Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....

  • 1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...

    1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...

  • A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that...

    A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that molecule will result in how many fragments?

  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • Question 18 4 pts What role do restriction enzymes play in bacteria? How do bacteria protect...

    Question 18 4 pts What role do restriction enzymes play in bacteria? How do bacteria protect their own DNA from the action of restriction enzymes? Change the surface proteins of bacteria; since DNA is not protein, there is no need for protection Cut foreign DNA into pieces; bacteria have RNA genomes. Destroy invading viral DNA: bacterial DNA does not contain the restriction enzyme recognition sequences. Restrict the growth rate of bacteria; bacterial DNA is restriction enzyme resistant. Question 18 4...

  • 3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...

    3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...

  • You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule...

    You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule that is 23,000 bp in length. You are using restriction enzymes and agarose gel electrophoresis in your experiments. You have decided to use two restriction endonucleases: Pstl and Tagl. The picture below shows their recognition sites, and the red arrows indicate their strand- Pstl (Providencia stuartii) CTGCAG GACGTC specific cleavage sites. Taqi (Thermus aquaticus) TCGA AGCT Part A: The Pstl and Taql enzymes both...

  • please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping...

    please help me with these questions Lab 8 Extension Activity: Plasmid Mapping and Restriction Enzymes Mapping the Plasmid The first step in mapping a plasmid is to determine how many times a restriction site is found on that plasmid. Examine the results for plasmid 55 as an example. The data given in the following table are for the double digest using EcoRI and Pstl. Also, giving are the data for single digests by the individual enzymes. The numbers in the...

  • Question 1 1 pts 1. You are classifying an organism based on the environment in which...

    Question 1 1 pts 1. You are classifying an organism based on the environment in which it was found. Select all that help classify the organism. This organism was found in the Dead Sea, known for its high salinity at 33% salt, and an average temperature of 25 degrees Celsius. The pH of the sea water was measured at 5.8. mesophile psychrophile hyperthermophile a obligate halophile facultative halophile acidophile neutrophile alkaliphile

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT