Question

You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule that is 23,000

Question 23 3 pts Part B: You perform a digestion of the squirrel mitochondrial DNA with Pstl and observe 4 bands on an agaro

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans-22- from the arrow it is clear that both produces sticky end after cleavage. Blunt ends are produced only when the cleave is straight perpendicular to the DNA.

Ans-23- since mitochondrial DNA is circular, number of fragments generated after cleavage would be equal to number of restriction site. So 4 is correct answer

Add a comment
Know the answer?
Add Answer to:
You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...

    You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...

  • 1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and...

    1. You perform a restriction endonuclease assay on an uncharacterized DNA molecule, using Pstl, Sall, and Xhol. When you run the DNA on a 1% agarose gel, you obtain the following information regarding fragment number and length (all lengths are in bp): Pstl (P) 700 200 Sall(s) 600 300 Xhol (X) 500 350 50 Pstl + Sall (P+S) 600 200 100 Pstl + Xhol (P+X) 500 200 150 50 Sall + Xhol (S+X) 500 250 100 50 Solve the following...

  • You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You...

    You are given a circular DNA molecule to analyze that is 3,000bp (3 Kb) long. You proceed to treat the DNA molecule with different cutting enzymes and then you run the individual reactions on a gel. The following gel is produced with each column representing a different reaction (lane). In lane 1 a molecule weight ladder is run. In lane 2, the circular DNA is NOT treated with any enzyme. In lane 3 the DNA is treated with an enzyme...

  • The figure below shows a restriction map of a segment of a DNA molecule. Eco refers...

    The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...

  • A linear piece of DNA has the following restrictions sites: You decided to set up an...

    A linear piece of DNA has the following restrictions sites: You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard and is comprised of a series of DNA fragments of known length). a) Which restriction...

  • please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA...

    please answer question numbe 2. Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...

  • Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel...

    Chromosomal and plasmid DNA can be cut into manageable pieces by restriction enzymes. Using agarose gel electrophoresis, the DNA fragments can be separated on a gel, based on their lengths. In order to see the fragments, a stain is typically added to the gel. The size of each fragment can be determined by comparing each one to a DNA molecular weight marker of known size. Below is a map of pBR22 plasmid. The position and base pair number of the...

  • In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB...

    In your previous prac session you digested your POTC-A plasmid DNA with 3 enzyme mixes (AB and C). One mix contained the restriction endonuclease Kpnl alone, another contained both del and Not and another contained Sphi and Nhe, but you don't know which was which yet. The sites where these enzymes cut POTC-A are indicated on the plasmid map at the top of the page. Calculate the sizes of the DNA fragments that you would expect to see on your...

  • please help if you can 3. You cloned a 20 kb piece of DNA, which contains...

    please help if you can 3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...

  • 8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to...

    8. You are studying a newly identified chromatin-remodeling complex, which you call NICRC. You decide to run an in vitro experiment to characterize the activity of the purified complex. Your molecular toolbox includes: (1) a 400-base-pair DNA molecule that has a single recognition site for the restriction endonuclease EcoRI, an enzyme that cleaves internal sites on double-stranded DNA (dsDNA); (2) purified EcoRI enzyme; (3) purified DNase I, a DNA endonuclease that will cleave dsDNA at nonspecific sites if they are...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT