A linear piece of DNA has the following restrictions sites:

You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard and is comprised of a series of DNA fragments of known length).

a) Which restriction enzyme would generate the fragment(s) shown on this gel. Explain how you arrived at your answer.
b) Explain how a restriction enzyme recognizes and cuts double-stranded DNA.
Answer A ) As in the result of gel electrophoresis image represent the two lane label as DNA ladder and sample. The lane of sample consist of two band and in reference to the DNA ladder band, the band present in sample lane are of 9 kb and 3 kb size.
If we carefully observe the image of linear DNA with restriction site, EcoRI is the one which will give fragment of 9 kb( 2kb+4kb+1kb +2kb) and 3 kb. Thus from this it can be concluded that EcoRI is the restriction enyme used in the sample.
Answer b ) Restriction enyme are the endonuclease enzyme which recognize the specific sequence which is present within the nucleotide strand and cut over it. theyare highly specific, once they recognize their specific sequence then pricisely cut within the sequence. As in case of EcoRI which cut at specific sequence 5' GAATTC 3'
THE DOUBLE STRAND DNA
5' G*AATTC 3'
3' CTTAA*G 5'
STAR * REPRESENT THE EXACT SITE WHERE THE EcoRI CUT.
There are three categories of restriction enzyme base on there recognition property.
TYPE 1 : These restriction enzyme recognize the specific site but cut randomly at 1000 base pair away from the recognition site. example EcoB RESTRICTION ENZYME
TYPE 2: These restriction enzyme recognize the site and cut within that rcognition site Example : EcoRI
TYPE 3 : These restriction enzyme recognition the specific site but cut site about 25 to 30 base pair away from the site . Example Ecop15
A linear piece of DNA has the following restrictions sites: You decided to set up an...
A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb 4 kb -> 1 kb 2 kb 3 kb You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
The figure below shows a restriction map of a segment of a DNA molecule. Eco refers to locations where the restriction endonuclease EcoRI cuts the DNA, and Pst refers to locations where the restriction enzyme Pst cuts the DNA. Potential restriction sites are numbered 1-6. Distances between restriction sites are shown on the bottom scale in base pairs (bp). The thick line represents the part of the molecule that has homology with a probe. Eco Pst Eco Pst Eco Pst...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....
Module 2 homework Laurel Jacqmai 0341 - Spring 20-MEEK > Activities and Due Dates > Module 2 homework Assignment Score: 20% Resources Hint Check Ans < Question 2 of 5 > EcoRI Control EcoRI BamHI BamHI Base pairs 10 kb Samples of a plasmid containing a segment of unknown DNA are digested using the restriction enzymes EcoRI, BamHI, and a combination of EcoRI and BamHI. The digests are then run on an agarose gel in order to separate the resulting...
You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule that is 23,000 bp in length. You are using restriction enzymes and agarose gel electrophoresis in your experiments. You have decided to use two restriction endonucleases: Pstl and Tagl. The picture below shows their recognition sites, and the red arrows indicate their strand- Pstl (Providencia stuartii) CTGCAG GACGTC specific cleavage sites. Taqi (Thermus aquaticus) TCGA AGCT Part A: The Pstl and Taql enzymes both...