Question a
Answer: The results of the gel electrophoresis showed two band of 7kb and 5 kb size. Digestion of the linear DNA with PstI restriction enzyme will generate two fragments of 7kb and 5 kb size. Digestion with other enzymes will to generate those fragments. Hence, PstI restriction enzyme s the correct answer (See the below figure).

Question b
Answer: Restriction enzymes recognizes certain sequence called as restriction sites and cut the DNA at that sites. Each restriction enzyme have unique restriction sites.
Restriction sites are usually 4-8bp in length and are palindromic sequence.
For example, restriction enzyme BamHI recognizes G^GATCC restriction site and cuts the DNA at that site.
A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb...
A linear piece of DNA has the following restrictions sites:
You decided to set up an experiment where you added one of these
restriction enzymes to this DNA. After this DNA was digested with
that restriction enzyme, you separated the resulting fragment(s)
using agarose electrophoresis. After the gel was stained with
ethidium bromide, you observed the following gel (the DNA ladder is
your reference standard and is comprised of a series of DNA
fragments of known length).
a) Which restriction...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Looking at the gel electrophoresis of pcDNA vector digestion with no enzyme, Xbal, or EcoRI below, answer the following question (#76). Remember pcDNA vector has both Xbal and EcoRI restriction enzyme sites within the multiple cloning sequence. GELA no enz Xbal Eceri ladder GEL B no enz_Xbal EceRl ladder 76. Which gel showed successful digestion (cutting) of the vector? A. Gel A B. Gel B C. Both A and B D. Neither Gel A or B E. Gel electrophoresis is...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1, 3 and 5 kb are seen. How many EcoRI sites are in the plasmid? Choose the one answer that is most correct. Group of answer choices: At least 2, At least 3, At least 5, None, At least 1, At least 4
1: EcoRI
2: BamHI
3:PstI
4:EcoRI + BamHI
5:EcoRI + PstI
6:BamHI + PstI
7: EcoRI + BamHI + PstI
Draw a restriction map of this plasmid.
To determine the restriction map of a plasmid, you
digest it with one or more of the three restriction enzymes EcoRI
BamHI and PstI. Sfter digestion, you anslyzr the size of the
fragments obtained on electrophoresis gel and you obtain the
following gel
piste1: EcoRI: 5400 bp
piste2: BamHI: 5400bp
piste3:PstlI: 4400bp ,...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
The PCR was a success and your target region of 770 bp in length has been amplified. You now plan to digest the DNA amplicon with the restriction enzyme Eael, and clone the resulting longest fragment it into the Eael site of the 5 kb plasmid diagrammed below. 770 bp BamHI 1 200 EcoRI 800 EcoRI 4000 1000 5 kb O /1000 2000 2000 Faal You purify your recombinant plasmid from bacterial cells, and run the plasmid (uncut. or not...
Aliquots of a 7.8-kilobase (kb) linear piece of DNA are digested with the restriction enzymes PvuII, HincII, ClaI, and BanII, alone and in pairs. The digestion products are separated by gel electrophoresis, and the size of each fragment is determined by comparison to size standards. The fragment sizes obtained, in kilobase pairs, are given below. Draw a diagram of the 7.8-kb fragment, showing the location of the restriction sites for each enzyme. a.Digestion with PvuII: 1.3 kb, 6.5 kb b.Digestion...