Use the following first-order Markov model for DNA sequences to answer Q4-Q5:

4. Draw out the graph for the above transition matrix.
5. If the current nucleotide in the sequence is an A, what will be the nucleotide in 100 steps?
The arrangement of nucleotides within a bacterial chromosome is influenced by numerous factors. The degeneracy of the third codon within each reading frame allows some flexibility of nucleotide selection; however, the third nucleotide in the triplet of each codon is at least partly determined by the preceding two. This is most evident in organisms with a strong G + C bias, as the degenerate codon must contribute disproportionately to maintaining that bias. Therefore, a correlation exists between the first two nucleotides and the third in all open reading frames. If the arrangement of nucleotides in a bacterial chromosome is represented as a Markov process, we would expect that the correlation would be completely captured by a second-order Markov model and an increase in the order of the model (e.g., third-, fourth-…order) would not capture any additional uncertainty in the process. In this manuscript, we present the results of a comprehensive study of the Markov property that exists in the DNA sequences of 906 bacterial chromosomes. All of the 906 bacterial chromosomes studied exhibit a statistically significant Markov property that extends beyond second-order, and therefore cannot be fully explained by codon usage. An unrooted tree containing all 906 bacterial chromosomes based on their transition probability matrices of third-order shares ∼25% similarity to a tree based on sequence homologies of 16S rRNA sequences. This congruence to the 16S rRNA tree is greater than for trees based on lower-order models (e.g., second-order), and higher-order models result in diminishing improvements in congruence. A nucleotide correlation most likely exists within every bacterial chromosome that extends past three nucleotides. This correlation places significant limits on the number of nucleotide sequences that can represent probable bacterial chromosomes. Transition matrix usage is largely conserved by taxa, indicating that this property is likely inherited, however some important exceptions exist that may indicate the convergent evolution of some bacteria.
Use the following first-order Markov model for DNA sequences to answer Q4-Q5: 4. Draw out the...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that assumes that from one time step to the next, the probability that the nucleotide remains unchanged equals 1-3α, for some α, 0 < α < 1 . If it does change (i.e., the nucleotide undergoes mutation), then it can change to any of...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
TASK II DNA Sequence DNA was also collected (Table 1). You are going to use this DNA sequence to complete the assignment Sacher, tochemelebiT.CO. DA A CARTIE CURIE CRET GARAGE MATIC I GREW E G CARETTING GUITAR HET GRATUIT TE GOOIT GENIET CARTIE CUCINE ACRET GARAGE GOTE GOOIT GRONIE I The DNA examined is 100 nucleotides of mitochondrial sequence, specifically the cytochrome Coxidase subunit I (MT-001) gene. This gene is often used as a DNA barcode to identity/differentiate animals at...
Use the DNA sequence below and the genetic code in your text to answer the following questions. Template DNA 3ʹ T A A G C G A T A C G A G A 5ʹ Non-template DNA 5ʹ A T T C G C T A T G C T C T 3ʹ What is the RNA sequence that would be transcribed from the sequence above? Include the 3ʹ and 5ʹ ends. (0.5) b) What is the amino acid sequence...
The answer is one of the
following:
Please be descriptive! Thank
you!
3. A Markov chain with state space S 1,2,3) has transition matrix 0.1 0.3 0.6 P-0 0.4 0.6 0.3 0.2 0.5 with initial distribution(0.2,0.3,0.5). Note that if you use the Markov Property, please indicate where you used it. Compute the following: (b) P(Xo 3| X1 1) Answers (in random order): 0.6,-2,-1,0, 1,2),5/36, 19/64,15/17.1/3 1-p p 1-p 0 1 00 0 1-p 0 114 0 3/4 1/21/2), 2/31/3). 0...
S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...
Use the following macroeconomic model to answer questions from Q1 through Q11: C 115 + 0.75Yd, where C = Consumption function; Yd (Y-T-Disposable income I 150; Investment G-200; G Government expenditure T-100; T = Tax revenue 40; X = Export M = 30; M-Import Also assume that Yf Full employment GDP (potential GDP) 2,000 a1. Estimate the equilibrium GDP level (income, Ye). Q2. Estimate the level of aggregate consumption (C) Q3. Estimate the level of aggregate saving (S) Q4. The...